Mutagenetix > Incidental Mutations

Incidental Mutation 'R2042:Ubr3'

225017

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

040049-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2042 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 69977774 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1200 (Q1200*)

Ref Sequence

ENSEMBL: ENSMUSP00000107870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

Predicted Effect

probably null
Transcript: ENSMUST00000055758
AA Change: Q1201*

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: Q1201*

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000112251
AA Change: Q1200*

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: Q1200*

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	A	3: 124,416,728		probably benign	Het
9130019O22Rik	A	T	7: 127,385,469	C154S	possibly damaging	Het
Abca16	G	A	7: 120,544,718	R1653Q	probably benign	Het
Ahnak2	T	A	12: 112,785,819	Y176F	probably damaging	Het
Ano6	T	C	15: 95,956,023		probably null	Het
Atr	T	C	9: 95,870,022	L564S	probably benign	Het
Birc6	C	G	17: 74,609,659	A1774G	probably damaging	Het
Cacng1	C	T	11: 107,704,308	A148T	probably damaging	Het
Cd53	T	A	3: 106,767,424		probably null	Het
Celsr2	A	G	3: 108,402,495	F1596S	probably damaging	Het
Cep120	A	T	18: 53,735,742	F122I	possibly damaging	Het
Ckm	A	T	7: 19,414,157	H7L	possibly damaging	Het
Crybg2	T	C	4: 134,087,533	V1575A	possibly damaging	Het
Cspp1	A	G	1: 10,112,538	E712G	probably damaging	Het
Cyp2b23	C	A	7: 26,666,108	R434L	probably damaging	Het
D630003M21Rik	A	T	2: 158,215,849	S570T	probably damaging	Het
Dmbt1	A	G	7: 131,106,359	I1444V	probably damaging	Het
Dnah8	T	C	17: 30,635,658	V98A	probably benign	Het
Dtx1	T	G	5: 120,694,476	N299T	probably benign	Het
Efr3b	T	A	12: 3,984,627	D65V	probably damaging	Het
Eml4	T	C	17: 83,448,178	C323R	probably damaging	Het
Eps15	C	T	4: 109,304,767	T31I	probably damaging	Het
Fam160a2	G	T	7: 105,384,121	Y629*	probably null	Het
Fam205c	C	T	4: 42,874,030	C46Y	possibly damaging	Het
Fam46b	T	C	4: 133,486,613	V265A	possibly damaging	Het
Fam91a1	A	G	15: 58,426,594	I184V	probably benign	Het
Fbxl8	A	T	8: 105,268,224	I123F	probably damaging	Het
Fbxw26	T	G	9: 109,732,704	T141P	probably damaging	Het
Glra3	G	A	8: 56,062,459	D190N	probably benign	Het
Hspg2	T	C	4: 137,568,366	L4229P	probably damaging	Het
Ipmk	C	T	10: 71,363,503	R65W	probably damaging	Het
Irs2	A	G	8: 11,007,580	I284T	probably damaging	Het
Klhl22	T	C	16: 17,792,420		probably benign	Het
Lmcd1	T	A	6: 112,315,890	D234E	probably benign	Het
Lrrc14b	T	C	13: 74,363,442	K173R	probably benign	Het
Magi1	A	T	6: 93,755,045	N209K	probably benign	Het
Mak	A	C	13: 41,049,436	S179A	possibly damaging	Het
Map3k4	C	A	17: 12,277,983	R87L	probably damaging	Het
Map4k1	T	C	7: 28,984,130	L53P	probably damaging	Het
Melk	T	C	4: 44,309,051		probably null	Het
Mks1	C	T	11: 87,856,668		probably benign	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
N4bp2	C	T	5: 65,826,621	P1670S	probably damaging	Het
Ncf1	C	G	5: 134,226,640	Q132H	probably benign	Het
Nemp1	T	C	10: 127,696,334	S370P	possibly damaging	Het
Nt5c3b	T	C	11: 100,436,194	H92R	probably benign	Het
Olfr1180	G	A	2: 88,412,202	A152V	possibly damaging	Het
Olfr527	T	C	7: 140,335,937	L25P	probably damaging	Het
P4ha3	T	C	7: 100,300,690		probably null	Het
Pcnx	C	A	12: 81,918,293	H411Q	probably damaging	Het
Podxl	A	G	6: 31,523,116	V473A	possibly damaging	Het
Prkd2	T	C	7: 16,856,268	S530P	possibly damaging	Het
Scin	A	G	12: 40,077,510	I427T	possibly damaging	Het
Sgo2b	T	C	8: 63,928,527	T424A	probably benign	Het
Slc22a2	T	C	17: 12,599,125	I196T	probably benign	Het
Slc47a2	C	A	11: 61,338,082	V90L	probably benign	Het
Slc4a7	G	A	14: 14,737,386	V99M	probably damaging	Het
Sprr2k	T	C	3: 92,433,456		probably benign	Het
Spta1	G	A	1: 174,211,647	M1185I	probably benign	Het
Uaca	T	C	9: 60,869,891	V518A	probably damaging	Het
Ufm1	A	G	3: 53,859,281		probably benign	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp142	G	A	1: 74,570,619	T1236I	probably benign	Het
Zfp236	A	G	18: 82,633,109	Y845H	probably damaging	Het
Zfp787	T	C	7: 6,132,764	K163E	possibly damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCGGGAACATTGAGCTCTCAC -3'
(R):5'- TGTGCTCAACAACAAAATGGC -3'

Sequencing Primer
(F):5'- GGAACATTGAGCTCTCACTTGAG -3'
(R):5'- GATTGACCTAAGTTGTCGCATGACC -3'

Posted On

2014-08-25