Incidental Mutation 'R2042:Ufm1'
ID225023
Institutional Source Beutler Lab
Gene Symbol Ufm1
Ensembl Gene ENSMUSG00000027746
Gene Nameubiquitin-fold modifier 1
Synonyms1810045K17Rik
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location53853376-53863830 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 53859281 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029309] [ENSMUST00000122330] [ENSMUST00000146598]
PDB Structure
Solution Structure of Mouse Hypothetical 9.1 kDa Protein, A Ubiquitin-like Fold [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029309
SMART Domains Protein: ENSMUSP00000029309
Gene: ENSMUSG00000027746

DomainStartEndE-ValueType
Pfam:Ufm1 2 55 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122330
SMART Domains Protein: ENSMUSP00000112586
Gene: ENSMUSG00000027746

DomainStartEndE-ValueType
Pfam:Ufm1 2 77 8.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146598
SMART Domains Protein: ENSMUSP00000118478
Gene: ENSMUSG00000027746

DomainStartEndE-ValueType
Pfam:Ufm1 3 77 1.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152414
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UFM1 is a ubiquitin-like protein that is conjugated to target proteins by E1-like activating enzyme UBA5 (UBE1DC1; MIM 610552) and E2-like conjugating enzyme UFC1 (MIM 610554) in a manner analogous to ubiquitylation (see UBE2M; MIM 603173) (Komatsu et al., 2004 [PubMed 15071506]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Ufm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Ufm1 UTSW 3 53859196 missense probably benign 0.34
R0458:Ufm1 UTSW 3 53861234 missense probably damaging 1.00
R5164:Ufm1 UTSW 3 53857927 utr 3 prime probably benign
R5809:Ufm1 UTSW 3 53857882 utr 3 prime probably benign
R6989:Ufm1 UTSW 3 53857981 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATGAAACCAATTATCAGCGAGAC -3'
(R):5'- AATTCGGGCCAGATACAGTGG -3'

Sequencing Primer
(F):5'- TTATCAGCGAGACAAGGAGACTGC -3'
(R):5'- CTCTGTGGCGCTTATGAAAACGTAC -3'
Posted On2014-08-25