Mutagenetix > Incidental Mutation

Incidental Mutation 'R1991:Cr2'

225056

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

040002-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R1991 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 195154150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1278 (P1278S)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000082321
AA Change: P902S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: P902S

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably benign
Transcript: ENSMUST00000193356
AA Change: P605S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: P605S

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193436

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195120
AA Change: P902S

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: P902S

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210219
AA Change: P1278S

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.1743

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (124/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,065,658	R203*	probably null	Het
Abcc2	A	T	19: 43,807,142	I446F	probably damaging	Het
Afap1l2	A	T	19: 57,002,267	I18N	possibly damaging	Het
Aida	A	T	1: 183,313,692	E107D	probably benign	Het
Amer2	A	G	14: 60,379,820	Y362C	probably damaging	Het
Amigo1	T	C	3: 108,187,328	S48P	probably benign	Het
Ano5	A	G	7: 51,537,813	K50R	possibly damaging	Het
Anxa2	A	T	9: 69,483,816	D95V	probably damaging	Het
Arhgap22	A	G	14: 33,366,959	N466D	probably damaging	Het
Armc3	T	C	2: 19,293,142	Y575H	probably damaging	Het
Ascc2	A	G	11: 4,679,257	E523G	probably benign	Het
B3galt5	A	T	16: 96,316,025	K286M	probably damaging	Het
Bag3	C	T	7: 128,545,683	H341Y	probably benign	Het
Blm	G	T	7: 80,505,949		probably null	Het
Cacna1b	G	A	2: 24,732,306	P222L	probably damaging	Het
Cap2	T	A	13: 46,637,881	Y175N	possibly damaging	Het
Cd81	G	T	7: 143,067,201	G206*	probably null	Het
Cep290	T	A	10: 100,531,184	S1132R	possibly damaging	Het
Cluh	C	A	11: 74,659,529	C222*	probably null	Het
Col14a1	A	T	15: 55,449,940	D1320V	unknown	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Cped1	A	G	6: 22,233,927	T847A	probably damaging	Het
Cpne7	A	G	8: 123,127,437	K288E	possibly damaging	Het
Creb3	C	A	4: 43,565,327	R202S	probably damaging	Het
Cyp2j9	T	A	4: 96,571,964	K434M	probably damaging	Het
Dpp10	A	T	1: 123,905,106	V48E	probably null	Het
Dsg2	A	G	18: 20,601,473	K836R	probably damaging	Het
Dst	A	G	1: 34,190,258	T1986A	probably benign	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Ecm2	A	G	13: 49,530,256	D570G	probably benign	Het
Efhc1	T	A	1: 20,989,560	C611*	probably null	Het
Epop	T	C	11: 97,628,654	T210A	probably benign	Het
Erc2	A	G	14: 28,011,636	I556V	probably benign	Het
Fdxacb1	A	T	9: 50,771,646	N101I	probably benign	Het
Fhad1	T	C	4: 141,982,162	S294G	possibly damaging	Het
Galnt16	A	G	12: 80,583,656	D262G	probably damaging	Het
Gm9573	A	T	17: 35,618,708	S1529T	probably benign	Het
Gorab	A	G	1: 163,397,056	S59P	probably damaging	Het
Gpr161	G	T	1: 165,306,563	M131I	probably damaging	Het
Gpr22	T	A	12: 31,709,203	M270L	probably benign	Het
Grin3b	C	A	10: 79,970,912	Q5K	probably benign	Het
Grin3b	C	T	10: 79,974,646	A662V	probably damaging	Het
Gsdmc	A	G	15: 63,801,899	I179T	probably benign	Het
Gsdmc2	T	A	15: 63,828,237	M229L	probably benign	Het
H2-Eb2	A	G	17: 34,334,304	I155V	probably benign	Het
Hoga1	A	C	19: 42,060,020		probably null	Het
Hs3st5	A	G	10: 36,832,886	Y139C	probably damaging	Het
Il10ra	C	A	9: 45,255,811	A481S	probably benign	Het
Ints2	T	A	11: 86,248,934	H278L	possibly damaging	Het
Kalrn	T	G	16: 33,975,738	L1222F	probably damaging	Het
Klhl25	T	A	7: 75,866,732	V157D	probably damaging	Het
Klk1b26	A	T	7: 44,016,900	T256S	probably damaging	Het
Krt81	T	C	15: 101,462,554	Q184R	probably benign	Het
Lce1k	A	T	3: 92,806,818	C20S	unknown	Het
Letm1	A	AG	5: 33,769,515		probably null	Het
Lin54	A	G	5: 100,485,801		probably null	Het
Lrrc37a	T	C	11: 103,500,261	E1446G	probably benign	Het
Macf1	A	G	4: 123,456,695	S3792P	probably damaging	Het
Manba	T	A	3: 135,551,191	D538E	probably benign	Het
Mcc	C	A	18: 44,491,315	E213*	probably null	Het
Mfap4	T	C	11: 61,485,807		probably null	Het
Nebl	T	A	2: 17,452,510	I80F	probably damaging	Het
Nek4	A	G	14: 30,956,953	I145V	probably damaging	Het
Nlrp14	T	C	7: 107,196,200	V230A	probably benign	Het
Nxf3	G	A	X: 136,075,834	P380S	possibly damaging	Het
Olfr1451	T	C	19: 12,999,502	V172A	possibly damaging	Het
Olfr403	T	C	11: 74,196,163	V220A	probably damaging	Het
Olfr421-ps1	C	T	1: 174,152,121	H202Y	probably damaging	Het
Olfr490	C	A	7: 108,286,359	G256*	probably null	Het
Olfr745	G	A	14: 50,642,866	C195Y	possibly damaging	Het
Pcdhb13	C	T	18: 37,443,859	T430I	possibly damaging	Het
Piezo2	A	T	18: 63,074,662	L1426Q	probably null	Het
Pigk	T	A	3: 152,744,494	Y212N	probably damaging	Het
Pigm	T	G	1: 172,377,261	L188R	probably damaging	Het
Plce1	T	C	19: 38,777,924	F2117S	probably damaging	Het
Plec	A	G	15: 76,173,543	F4055L	probably damaging	Het
Plk5	C	T	10: 80,363,102	S435L	possibly damaging	Het
Pms1	G	A	1: 53,282,042	L11F	probably damaging	Het
Prl3b1	C	T	13: 27,247,912	T140I	possibly damaging	Het
Prl7a1	T	G	13: 27,633,672	D203A	probably damaging	Het
Psg17	A	G	7: 18,814,652	V398A	probably benign	Het
Pum1	T	A	4: 130,718,218	I166K	possibly damaging	Het
R3hdm1	T	A	1: 128,169,016	D108E	probably damaging	Het
Reln	A	T	5: 21,969,360	D1948E	possibly damaging	Het
Rnf112	C	T	11: 61,452,426	R141Q	probably damaging	Het
Rnf145	T	C	11: 44,561,466	V424A	possibly damaging	Het
Serpina3m	C	A	12: 104,389,699	Y208*	probably null	Het
Serpind1	T	C	16: 17,342,944	V446A	probably benign	Het
Shc3	T	A	13: 51,442,836	M384L	probably benign	Het
Slc38a11	A	G	2: 65,330,339	F304L	probably benign	Het
Slpi	C	T	2: 164,355,543	C28Y	probably damaging	Het
Specc1	C	A	11: 62,029,294	P7T	possibly damaging	Het
Spib	T	C	7: 44,528,857	E180G	probably benign	Het
Spint5	T	C	2: 164,716,983		probably benign	Het
Ssr2	T	A	3: 88,576,867		probably benign	Het
Tbrg1	T	C	9: 37,649,419	D387G	probably benign	Het
Tex14	T	G	11: 87,549,470	L1367R	probably damaging	Het
Tfpi	A	C	2: 84,458,016		probably benign	Het
Tlr5	T	A	1: 182,974,347	D405E	probably damaging	Het
Tnnt3	C	T	7: 142,511,525	R131C	possibly damaging	Het
Tnxb	T	C	17: 34,671,904	V407A	probably damaging	Het
Tnxb	A	G	17: 34,682,251	Y1013C	probably damaging	Het
Tpx2	T	A	2: 152,890,624	M606K	probably benign	Het
Trim30a	T	A	7: 104,430,230		probably benign	Het
Trim46	A	T	3: 89,237,701	Y489N	probably damaging	Het
Trpm6	A	T	19: 18,796,284	H380L	probably benign	Het
Tstd2	A	G	4: 46,120,563	I279T	probably benign	Het
Ttn	C	T	2: 76,946,391		probably null	Het
Txnl1	T	C	18: 63,679,514	T70A	probably benign	Het
Ush2a	C	T	1: 188,578,532		probably benign	Het
Usp1	A	G	4: 98,934,294	D615G	probably benign	Het
Virma	T	A	4: 11,519,242	C830S	probably benign	Het
Vmn1r7	A	T	6: 57,024,868	S136T	probably benign	Het
Vmn2r9	A	G	5: 108,846,439	V448A	probably damaging	Het
Vps11	G	A	9: 44,359,227	H183Y	probably damaging	Het
Vsig10l	A	G	7: 43,467,468	T476A	possibly damaging	Het
Wdr63	G	T	3: 146,063,480	T522K	possibly damaging	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt8a	A	G	18: 34,544,884	D115G	probably damaging	Het
Xndc1	T	A	7: 102,073,191	V21E	probably damaging	Het
Zc3hav1	C	A	6: 38,336,517	V198L	probably damaging	Het
Zfp874a	T	A	13: 67,442,504	I354F	probably benign	Het
Zfr2	A	T	10: 81,242,852	D306V	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GGGATGTTTGTCAAATGCACTC -3'
(R):5'- CCAAGCTTCTTTAGGGTGTCAGTC -3'

Sequencing Primer
(F):5'- ACAATAGGGTCACTATAGCAA -3'
(R):5'- AGGGTGTCAGTCTCCATCCAC -3'

Posted On

2014-08-25