Incidental Mutation 'R0144:Olfr593'
List |< first << previous [record 56 of 76] next >> last >|
ID22507
Institutional Source Beutler Lab
Gene Symbol Olfr593
Ensembl Gene ENSMUSG00000073955
Gene Nameolfactory receptor 593
SynonymsGA_x6K02T2PBJ9-5927412-5928362, MOR24-2
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0144 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location103211862-103212845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103212540 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 216 (I216F)
Ref Sequence ENSEMBL: ENSMUSP00000147588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098206] [ENSMUST00000210686] [ENSMUST00000214051]
Predicted Effect probably damaging
Transcript: ENSMUST00000098206
AA Change: I227F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095807
Gene: ENSMUSG00000073955
AA Change: I227F

DomainStartEndE-ValueType
Pfam:7tm_4 44 323 4.9e-106 PFAM
Pfam:7TM_GPCR_Srsx 48 320 2.6e-8 PFAM
Pfam:7tm_1 54 305 6.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210686
AA Change: I216F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214051
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Olfr593
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Olfr593 APN 7 103212685 missense probably damaging 1.00
IGL01636:Olfr593 APN 7 103212177 missense probably benign
IGL01637:Olfr593 APN 7 103212177 missense probably benign
IGL02115:Olfr593 APN 7 103212474 missense probably damaging 1.00
IGL02668:Olfr593 APN 7 103212735 missense possibly damaging 0.88
IGL03063:Olfr593 APN 7 103212634 missense probably damaging 0.96
IGL03070:Olfr593 APN 7 103212697 missense probably benign 0.02
IGL03114:Olfr593 APN 7 103212721 missense probably damaging 1.00
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0309:Olfr593 UTSW 7 103212721 missense probably damaging 1.00
R0602:Olfr593 UTSW 7 103212580 missense possibly damaging 0.76
R0677:Olfr593 UTSW 7 103212798 nonsense probably null
R0783:Olfr593 UTSW 7 103212670 missense probably damaging 1.00
R1829:Olfr593 UTSW 7 103211886 missense probably benign 0.01
R3840:Olfr593 UTSW 7 103212693 missense probably damaging 1.00
R3841:Olfr593 UTSW 7 103212693 missense probably damaging 1.00
R4449:Olfr593 UTSW 7 103212480 missense probably benign 0.00
R4898:Olfr593 UTSW 7 103212540 missense probably damaging 1.00
R5197:Olfr593 UTSW 7 103212000 missense probably benign 0.02
R5285:Olfr593 UTSW 7 103212798 nonsense probably null
R6548:Olfr593 UTSW 7 103211904 missense probably benign 0.08
R7353:Olfr593 UTSW 7 103212309 missense probably damaging 1.00
R7362:Olfr593 UTSW 7 103212654 missense probably damaging 1.00
R7663:Olfr593 UTSW 7 103212445 missense possibly damaging 0.74
R7799:Olfr593 UTSW 7 103211979 missense probably benign 0.33
R8405:Olfr593 UTSW 7 103212201 missense probably benign 0.31
R8835:Olfr593 UTSW 7 103212721 missense probably damaging 1.00
X0067:Olfr593 UTSW 7 103212048 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAAGCTTGCCTCACTCAGATCTTCC -3'
(R):5'- AGCCACCTTGTGCCCAAATCTATG -3'

Sequencing Primer
(F):5'- TTTGACACACACTGTAACTGGAGG -3'
(R):5'- TCTATGGGTAAGGAAGGAGAAGAAG -3'
Posted On2013-04-16