Incidental Mutation 'R2042:P4ha3'
ID225070
Institutional Source Beutler Lab
Gene Symbol P4ha3
Ensembl Gene ENSMUSG00000051048
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100285520-100319699 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 100300690 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000057023] [ENSMUST00000057023] [ENSMUST00000139790] [ENSMUST00000139790]
Predicted Effect probably null
Transcript: ENSMUST00000057023
SMART Domains Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:P4Ha_N 31 159 1.4e-31 PFAM
SCOP:d1ihga1 177 258 8e-4 SMART
P4Hc 344 526 1.08e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000057023
SMART Domains Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:P4Ha_N 31 159 1.4e-31 PFAM
SCOP:d1ihga1 177 258 8e-4 SMART
P4Hc 344 526 1.08e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138465
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138465
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138465
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138465
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139790
SMART Domains Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139790
SMART Domains Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208565
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in P4ha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:P4ha3 APN 7 100305933 missense probably damaging 1.00
IGL01875:P4ha3 APN 7 100300652 missense probably damaging 0.97
IGL02265:P4ha3 APN 7 100293932 missense probably benign
IGL02957:P4ha3 APN 7 100318905 splice site probably benign
IGL03279:P4ha3 APN 7 100300686 missense probably damaging 1.00
R0006:P4ha3 UTSW 7 100318948 nonsense probably null
R0880:P4ha3 UTSW 7 100305909 missense probably benign 0.06
R1066:P4ha3 UTSW 7 100318063 missense possibly damaging 0.77
R1118:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1119:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1236:P4ha3 UTSW 7 100293849 missense probably damaging 1.00
R1613:P4ha3 UTSW 7 100313250 missense possibly damaging 0.95
R1778:P4ha3 UTSW 7 100300691 splice site probably null
R3437:P4ha3 UTSW 7 100285624 missense possibly damaging 0.93
R4393:P4ha3 UTSW 7 100305607 missense probably benign 0.06
R5411:P4ha3 UTSW 7 100293815 missense probably damaging 1.00
R5722:P4ha3 UTSW 7 100305991 missense probably benign 0.03
R6209:P4ha3 UTSW 7 100317085 missense probably benign 0.09
R6462:P4ha3 UTSW 7 100314666 missense probably damaging 1.00
R6606:P4ha3 UTSW 7 100305644 missense probably damaging 0.99
R7578:P4ha3 UTSW 7 100293914 missense probably benign 0.02
R7769:P4ha3 UTSW 7 100285717 missense probably damaging 0.97
R8031:P4ha3 UTSW 7 100292698 missense probably damaging 1.00
R8090:P4ha3 UTSW 7 100300652 missense probably damaging 0.97
R8296:P4ha3 UTSW 7 100317102 missense probably damaging 1.00
R8379:P4ha3 UTSW 7 100293779 missense probably damaging 0.99
R8501:P4ha3 UTSW 7 100313355 missense probably damaging 1.00
R8516:P4ha3 UTSW 7 100314662 missense probably damaging 0.97
RF033:P4ha3 UTSW 7 100310810 frame shift probably null
Z1177:P4ha3 UTSW 7 100293788 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGGAGACTTGATTTGTCACAGG -3'
(R):5'- CACGAGCGTGTGCACACA -3'

Sequencing Primer
(F):5'- CGGACCAAACAATATTCTGCATTC -3'
(R):5'- GTGCACACACACACACAC -3'
Posted On2014-08-25