Incidental Mutation 'R2042:9130019O22Rik'
ID225078
Institutional Source Beutler Lab
Gene Symbol 9130019O22Rik
Ensembl Gene ENSMUSG00000030823
Gene NameRIKEN cDNA 9130019O22 gene
Synonyms
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127382260-127387166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127385469 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 154 (C154S)
Ref Sequence ENSEMBL: ENSMUSP00000038195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000164345] [ENSMUST00000165495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049052
AA Change: C154S

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823
AA Change: C154S

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165495
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Meta Mutation Damage Score 0.7725 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in 9130019O22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:9130019O22Rik APN 7 127386544 unclassified probably benign
IGL03102:9130019O22Rik APN 7 127384779 missense probably benign 0.01
IGL03264:9130019O22Rik APN 7 127385639 unclassified probably benign
R1653:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R1692:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R2132:9130019O22Rik UTSW 7 127386935 missense probably benign
R3768:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3769:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3770:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R4459:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4461:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4839:9130019O22Rik UTSW 7 127385007 missense probably benign 0.32
R4903:9130019O22Rik UTSW 7 127385406 missense probably benign 0.02
R5231:9130019O22Rik UTSW 7 127385414 missense probably damaging 0.98
R5324:9130019O22Rik UTSW 7 127384907 unclassified probably benign
R5735:9130019O22Rik UTSW 7 127385407 missense possibly damaging 0.60
R5808:9130019O22Rik UTSW 7 127384913 unclassified probably benign
R6429:9130019O22Rik UTSW 7 127385042 unclassified probably benign
R6571:9130019O22Rik UTSW 7 127385138 unclassified probably benign
R6655:9130019O22Rik UTSW 7 127384340 missense possibly damaging 0.96
R6806:9130019O22Rik UTSW 7 127386594 unclassified probably benign
R6962:9130019O22Rik UTSW 7 127384315 missense possibly damaging 0.70
R7091:9130019O22Rik UTSW 7 127384362 missense possibly damaging 0.70
R7204:9130019O22Rik UTSW 7 127384346 missense possibly damaging 0.92
R7218:9130019O22Rik UTSW 7 127384680 missense probably benign 0.32
R7570:9130019O22Rik UTSW 7 127385283 missense probably benign 0.00
R7604:9130019O22Rik UTSW 7 127386535 missense unknown
R7661:9130019O22Rik UTSW 7 127384963 nonsense probably null
R7893:9130019O22Rik UTSW 7 127386544 unclassified probably benign
R8323:9130019O22Rik UTSW 7 127384449 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGTGTACATGTGTGCCACC -3'
(R):5'- ATGGTCTCCCAGCAGATTGC -3'

Sequencing Primer
(F):5'- CATGTGTGCCACCAGTTTGGAC -3'
(R):5'- GCAGATTGCAGGCACGAG -3'
Posted On2014-08-25