Incidental Mutation 'R2042:Olfr527'
ID225082
Institutional Source Beutler Lab
Gene Symbol Olfr527
Ensembl Gene ENSMUSG00000062782
Gene Nameolfactory receptor 527
SynonymsGA_x6K02T2PBJ9-42486061-42486978, MOR251-5
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140334017-140338551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140335937 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 25 (L25P)
Ref Sequence ENSEMBL: ENSMUSP00000149080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172230] [ENSMUST00000214143] [ENSMUST00000214858]
Predicted Effect probably damaging
Transcript: ENSMUST00000172230
AA Change: L25P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129414
Gene: ENSMUSG00000062782
AA Change: L25P

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 179 9.1e-8 PFAM
Pfam:7tm_1 39 287 7.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214143
AA Change: L25P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000214858
AA Change: L25P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Olfr527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02818:Olfr527 APN 7 140336606 missense possibly damaging 0.90
IGL02885:Olfr527 APN 7 140336159 missense possibly damaging 0.94
R1340:Olfr527 UTSW 7 140336125 missense probably benign 0.10
R1711:Olfr527 UTSW 7 140335999 missense possibly damaging 0.55
R1860:Olfr527 UTSW 7 140336219 missense possibly damaging 0.78
R2072:Olfr527 UTSW 7 140336653 missense possibly damaging 0.85
R2128:Olfr527 UTSW 7 140336429 missense probably damaging 1.00
R2347:Olfr527 UTSW 7 140336147 missense probably damaging 0.98
R2449:Olfr527 UTSW 7 140336432 missense probably benign
R2973:Olfr527 UTSW 7 140336387 missense probably damaging 1.00
R3151:Olfr527 UTSW 7 140336330 missense probably benign 0.01
R4320:Olfr527 UTSW 7 140336306 missense possibly damaging 0.94
R5561:Olfr527 UTSW 7 140336152 nonsense probably null
R5566:Olfr527 UTSW 7 140336067 missense probably damaging 1.00
R5891:Olfr527 UTSW 7 140336600 missense probably benign 0.06
R7227:Olfr527 UTSW 7 140335621 start gained probably benign
R7296:Olfr527 UTSW 7 140336741 missense possibly damaging 0.91
R7568:Olfr527 UTSW 7 140335982 missense probably damaging 1.00
R8000:Olfr527 UTSW 7 140336342 missense possibly damaging 0.61
R8171:Olfr527 UTSW 7 140336230 missense probably damaging 1.00
R8203:Olfr527 UTSW 7 140336026 missense probably benign 0.14
R8351:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
R8451:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCAACACATCTGCATTGGG -3'
(R):5'- CCCGTAAGAGATGGTCCTTC -3'

Sequencing Primer
(F):5'- CAACACATCTGCATTGGGTCGTTAG -3'
(R):5'- AAGAGATGGTCCTTCCTGTCATCATG -3'
Posted On2014-08-25