Mutagenetix > Incidental Mutations

Incidental Mutation 'R2042:Olfr527'

225082

Institutional Source

Beutler Lab

Gene Symbol

Olfr527

Ensembl Gene

ENSMUSG00000062782

Gene Name

olfactory receptor 527

Synonyms

GA_x6K02T2PBJ9-42486061-42486978, MOR251-5

MMRRC Submission

040049-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R2042 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140334017-140338551 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140335937 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 25 (L25P)

Ref Sequence

ENSEMBL: ENSMUSP00000149080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172230] [ENSMUST00000214143] [ENSMUST00000214858]

Predicted Effect

probably damaging
Transcript: ENSMUST00000172230
AA Change: L25P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129414
Gene: ENSMUSG00000062782
AA Change: L25P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	304	1.8e-45	PFAM
Pfam:7TM_GPCR_Srsx	33	179	9.1e-8	PFAM
Pfam:7tm_1	39	287	7.2e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214143
AA Change: L25P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214858
AA Change: L25P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	A	3: 124,416,728		probably benign	Het
9130019O22Rik	A	T	7: 127,385,469	C154S	possibly damaging	Het
Abca16	G	A	7: 120,544,718	R1653Q	probably benign	Het
Ahnak2	T	A	12: 112,785,819	Y176F	probably damaging	Het
Ano6	T	C	15: 95,956,023		probably null	Het
Atr	T	C	9: 95,870,022	L564S	probably benign	Het
Birc6	C	G	17: 74,609,659	A1774G	probably damaging	Het
Cacng1	C	T	11: 107,704,308	A148T	probably damaging	Het
Cd53	T	A	3: 106,767,424		probably null	Het
Celsr2	A	G	3: 108,402,495	F1596S	probably damaging	Het
Cep120	A	T	18: 53,735,742	F122I	possibly damaging	Het
Ckm	A	T	7: 19,414,157	H7L	possibly damaging	Het
Crybg2	T	C	4: 134,087,533	V1575A	possibly damaging	Het
Cspp1	A	G	1: 10,112,538	E712G	probably damaging	Het
Cyp2b23	C	A	7: 26,666,108	R434L	probably damaging	Het
D630003M21Rik	A	T	2: 158,215,849	S570T	probably damaging	Het
Dmbt1	A	G	7: 131,106,359	I1444V	probably damaging	Het
Dnah8	T	C	17: 30,635,658	V98A	probably benign	Het
Dtx1	T	G	5: 120,694,476	N299T	probably benign	Het
Efr3b	T	A	12: 3,984,627	D65V	probably damaging	Het
Eml4	T	C	17: 83,448,178	C323R	probably damaging	Het
Eps15	C	T	4: 109,304,767	T31I	probably damaging	Het
Fam160a2	G	T	7: 105,384,121	Y629*	probably null	Het
Fam205c	C	T	4: 42,874,030	C46Y	possibly damaging	Het
Fam46b	T	C	4: 133,486,613	V265A	possibly damaging	Het
Fam91a1	A	G	15: 58,426,594	I184V	probably benign	Het
Fbxl8	A	T	8: 105,268,224	I123F	probably damaging	Het
Fbxw26	T	G	9: 109,732,704	T141P	probably damaging	Het
Glra3	G	A	8: 56,062,459	D190N	probably benign	Het
Hspg2	T	C	4: 137,568,366	L4229P	probably damaging	Het
Ipmk	C	T	10: 71,363,503	R65W	probably damaging	Het
Irs2	A	G	8: 11,007,580	I284T	probably damaging	Het
Klhl22	T	C	16: 17,792,420		probably benign	Het
Lmcd1	T	A	6: 112,315,890	D234E	probably benign	Het
Lrrc14b	T	C	13: 74,363,442	K173R	probably benign	Het
Magi1	A	T	6: 93,755,045	N209K	probably benign	Het
Mak	A	C	13: 41,049,436	S179A	possibly damaging	Het
Map3k4	C	A	17: 12,277,983	R87L	probably damaging	Het
Map4k1	T	C	7: 28,984,130	L53P	probably damaging	Het
Melk	T	C	4: 44,309,051		probably null	Het
Mks1	C	T	11: 87,856,668		probably benign	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
N4bp2	C	T	5: 65,826,621	P1670S	probably damaging	Het
Ncf1	C	G	5: 134,226,640	Q132H	probably benign	Het
Nemp1	T	C	10: 127,696,334	S370P	possibly damaging	Het
Nt5c3b	T	C	11: 100,436,194	H92R	probably benign	Het
Olfr1180	G	A	2: 88,412,202	A152V	possibly damaging	Het
P4ha3	T	C	7: 100,300,690		probably null	Het
Pcnx	C	A	12: 81,918,293	H411Q	probably damaging	Het
Podxl	A	G	6: 31,523,116	V473A	possibly damaging	Het
Prkd2	T	C	7: 16,856,268	S530P	possibly damaging	Het
Scin	A	G	12: 40,077,510	I427T	possibly damaging	Het
Sgo2b	T	C	8: 63,928,527	T424A	probably benign	Het
Slc22a2	T	C	17: 12,599,125	I196T	probably benign	Het
Slc47a2	C	A	11: 61,338,082	V90L	probably benign	Het
Slc4a7	G	A	14: 14,737,386	V99M	probably damaging	Het
Sprr2k	T	C	3: 92,433,456		probably benign	Het
Spta1	G	A	1: 174,211,647	M1185I	probably benign	Het
Uaca	T	C	9: 60,869,891	V518A	probably damaging	Het
Ubr3	C	T	2: 69,977,774	Q1200*	probably null	Het
Ufm1	A	G	3: 53,859,281		probably benign	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp142	G	A	1: 74,570,619	T1236I	probably benign	Het
Zfp236	A	G	18: 82,633,109	Y845H	probably damaging	Het
Zfp787	T	C	7: 6,132,764	K163E	possibly damaging	Het

Other mutations in Olfr527

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02818:Olfr527	APN	7	140336606	missense	possibly damaging	0.90
IGL02885:Olfr527	APN	7	140336159	missense	possibly damaging	0.94
R1340:Olfr527	UTSW	7	140336125	missense	probably benign	0.10
R1711:Olfr527	UTSW	7	140335999	missense	possibly damaging	0.55
R1860:Olfr527	UTSW	7	140336219	missense	possibly damaging	0.78
R2072:Olfr527	UTSW	7	140336653	missense	possibly damaging	0.85
R2128:Olfr527	UTSW	7	140336429	missense	probably damaging	1.00
R2347:Olfr527	UTSW	7	140336147	missense	probably damaging	0.98
R2449:Olfr527	UTSW	7	140336432	missense	probably benign
R2973:Olfr527	UTSW	7	140336387	missense	probably damaging	1.00
R3151:Olfr527	UTSW	7	140336330	missense	probably benign	0.01
R4320:Olfr527	UTSW	7	140336306	missense	possibly damaging	0.94
R5561:Olfr527	UTSW	7	140336152	nonsense	probably null
R5566:Olfr527	UTSW	7	140336067	missense	probably damaging	1.00
R5891:Olfr527	UTSW	7	140336600	missense	probably benign	0.06
R7227:Olfr527	UTSW	7	140335621	start gained	probably benign
R7296:Olfr527	UTSW	7	140336741	missense	possibly damaging	0.91
R7568:Olfr527	UTSW	7	140335982	missense	probably damaging	1.00
R8000:Olfr527	UTSW	7	140336342	missense	possibly damaging	0.61
R8171:Olfr527	UTSW	7	140336230	missense	probably damaging	1.00
R8203:Olfr527	UTSW	7	140336026	missense	probably benign	0.14
R8351:Olfr527	UTSW	7	140336605	missense	probably damaging	1.00
R8451:Olfr527	UTSW	7	140336605	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTCAACACATCTGCATTGGG -3'
(R):5'- CCCGTAAGAGATGGTCCTTC -3'

Sequencing Primer
(F):5'- CAACACATCTGCATTGGGTCGTTAG -3'
(R):5'- AAGAGATGGTCCTTCCTGTCATCATG -3'

Posted On

2014-08-25