Mutagenetix > Incidental Mutations

Incidental Mutation 'R2042:Irs2'

225084

Institutional Source

Beutler Lab

Gene Symbol

Irs2

Ensembl Gene

ENSMUSG00000038894

Gene Name

insulin receptor substrate 2

Synonyms

Irs-2

MMRRC Submission

040049-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.511) question?

Stock #

R2042 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10984681-11008458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11007580 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 284 (I284T)

Ref Sequence

ENSEMBL: ENSMUSP00000038514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040514]

PDB Structure

Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040514
AA Change: I284T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: I284T

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	19	28	N/A	INTRINSIC
PH	31	146	2.83e-13	SMART
IRS	191	293	4.98e-38	SMART
PTBI	191	293	2.24e-51	SMART
low complexity region	301	309	N/A	INTRINSIC
low complexity region	364	377	N/A	INTRINSIC
low complexity region	435	473	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	688	710	N/A	INTRINSIC
low complexity region	721	730	N/A	INTRINSIC
low complexity region	834	846	N/A	INTRINSIC
low complexity region	923	959	N/A	INTRINSIC
low complexity region	976	984	N/A	INTRINSIC
low complexity region	997	1028	N/A	INTRINSIC
low complexity region	1137	1154	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC
low complexity region	1274	1296	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180750

Meta Mutation Damage Score

0.6865

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	A	3: 124,416,728		probably benign	Het
9130019O22Rik	A	T	7: 127,385,469	C154S	possibly damaging	Het
Abca16	G	A	7: 120,544,718	R1653Q	probably benign	Het
Ahnak2	T	A	12: 112,785,819	Y176F	probably damaging	Het
Ano6	T	C	15: 95,956,023		probably null	Het
Atr	T	C	9: 95,870,022	L564S	probably benign	Het
Birc6	C	G	17: 74,609,659	A1774G	probably damaging	Het
Cacng1	C	T	11: 107,704,308	A148T	probably damaging	Het
Cd53	T	A	3: 106,767,424		probably null	Het
Celsr2	A	G	3: 108,402,495	F1596S	probably damaging	Het
Cep120	A	T	18: 53,735,742	F122I	possibly damaging	Het
Ckm	A	T	7: 19,414,157	H7L	possibly damaging	Het
Crybg2	T	C	4: 134,087,533	V1575A	possibly damaging	Het
Cspp1	A	G	1: 10,112,538	E712G	probably damaging	Het
Cyp2b23	C	A	7: 26,666,108	R434L	probably damaging	Het
D630003M21Rik	A	T	2: 158,215,849	S570T	probably damaging	Het
Dmbt1	A	G	7: 131,106,359	I1444V	probably damaging	Het
Dnah8	T	C	17: 30,635,658	V98A	probably benign	Het
Dtx1	T	G	5: 120,694,476	N299T	probably benign	Het
Efr3b	T	A	12: 3,984,627	D65V	probably damaging	Het
Eml4	T	C	17: 83,448,178	C323R	probably damaging	Het
Eps15	C	T	4: 109,304,767	T31I	probably damaging	Het
Fam160a2	G	T	7: 105,384,121	Y629*	probably null	Het
Fam205c	C	T	4: 42,874,030	C46Y	possibly damaging	Het
Fam46b	T	C	4: 133,486,613	V265A	possibly damaging	Het
Fam91a1	A	G	15: 58,426,594	I184V	probably benign	Het
Fbxl8	A	T	8: 105,268,224	I123F	probably damaging	Het
Fbxw26	T	G	9: 109,732,704	T141P	probably damaging	Het
Glra3	G	A	8: 56,062,459	D190N	probably benign	Het
Hspg2	T	C	4: 137,568,366	L4229P	probably damaging	Het
Ipmk	C	T	10: 71,363,503	R65W	probably damaging	Het
Klhl22	T	C	16: 17,792,420		probably benign	Het
Lmcd1	T	A	6: 112,315,890	D234E	probably benign	Het
Lrrc14b	T	C	13: 74,363,442	K173R	probably benign	Het
Magi1	A	T	6: 93,755,045	N209K	probably benign	Het
Mak	A	C	13: 41,049,436	S179A	possibly damaging	Het
Map3k4	C	A	17: 12,277,983	R87L	probably damaging	Het
Map4k1	T	C	7: 28,984,130	L53P	probably damaging	Het
Melk	T	C	4: 44,309,051		probably null	Het
Mks1	C	T	11: 87,856,668		probably benign	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
N4bp2	C	T	5: 65,826,621	P1670S	probably damaging	Het
Ncf1	C	G	5: 134,226,640	Q132H	probably benign	Het
Nemp1	T	C	10: 127,696,334	S370P	possibly damaging	Het
Nt5c3b	T	C	11: 100,436,194	H92R	probably benign	Het
Olfr1180	G	A	2: 88,412,202	A152V	possibly damaging	Het
Olfr527	T	C	7: 140,335,937	L25P	probably damaging	Het
P4ha3	T	C	7: 100,300,690		probably null	Het
Pcnx	C	A	12: 81,918,293	H411Q	probably damaging	Het
Podxl	A	G	6: 31,523,116	V473A	possibly damaging	Het
Prkd2	T	C	7: 16,856,268	S530P	possibly damaging	Het
Scin	A	G	12: 40,077,510	I427T	possibly damaging	Het
Sgo2b	T	C	8: 63,928,527	T424A	probably benign	Het
Slc22a2	T	C	17: 12,599,125	I196T	probably benign	Het
Slc47a2	C	A	11: 61,338,082	V90L	probably benign	Het
Slc4a7	G	A	14: 14,737,386	V99M	probably damaging	Het
Sprr2k	T	C	3: 92,433,456		probably benign	Het
Spta1	G	A	1: 174,211,647	M1185I	probably benign	Het
Uaca	T	C	9: 60,869,891	V518A	probably damaging	Het
Ubr3	C	T	2: 69,977,774	Q1200*	probably null	Het
Ufm1	A	G	3: 53,859,281		probably benign	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp142	G	A	1: 74,570,619	T1236I	probably benign	Het
Zfp236	A	G	18: 82,633,109	Y845H	probably damaging	Het
Zfp787	T	C	7: 6,132,764	K163E	possibly damaging	Het

Other mutations in Irs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Irs2	APN	8	11005867	missense	probably benign	0.00
IGL01328:Irs2	APN	8	11004792	missense	probably damaging	0.99
IGL01875:Irs2	APN	8	11006221	missense	probably damaging	0.98
IGL02444:Irs2	APN	8	11006306	missense	probably benign	0.03
IGL02448:Irs2	APN	8	11007862	missense	probably benign	0.21
IGL02945:Irs2	APN	8	11007781	missense	probably damaging	1.00
IGL03068:Irs2	APN	8	11004974	missense	probably damaging	0.99
beefed	UTSW	8	11006522	nonsense	probably null
Dum_dum	UTSW	8	10987012	makesense	probably null
Lush	UTSW	8	11006678	nonsense	probably null
muscular	UTSW	8	11004659	nonsense	probably null
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0107:Irs2	UTSW	8	11004691	missense	probably damaging	1.00
R0147:Irs2	UTSW	8	11007568	missense	probably damaging	1.00
R0501:Irs2	UTSW	8	11006396	missense	probably damaging	1.00
R0565:Irs2	UTSW	8	11004592	missense	probably damaging	0.98
R2268:Irs2	UTSW	8	11007586	missense	probably damaging	0.98
R2518:Irs2	UTSW	8	11005352	missense	probably benign	0.00
R2762:Irs2	UTSW	8	11006408	missense	probably damaging	1.00
R3623:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R3624:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R5022:Irs2	UTSW	8	10987012	makesense	probably null
R5270:Irs2	UTSW	8	11006678	nonsense	probably null
R5377:Irs2	UTSW	8	11005277	missense	probably benign	0.00
R5604:Irs2	UTSW	8	11005007	missense	possibly damaging	0.84
R6049:Irs2	UTSW	8	11006805	missense	probably benign	0.01
R6219:Irs2	UTSW	8	11005121	missense	probably damaging	0.99
R6654:Irs2	UTSW	8	11006486	missense	probably damaging	1.00
R6726:Irs2	UTSW	8	11004961	missense	possibly damaging	0.86
R6813:Irs2	UTSW	8	11004659	nonsense	probably null
R6934:Irs2	UTSW	8	11004697	missense	probably damaging	0.99
R7261:Irs2	UTSW	8	11007018	missense	possibly damaging	0.95
R7285:Irs2	UTSW	8	11006797	missense	probably damaging	0.99
R7458:Irs2	UTSW	8	11007739	missense	probably damaging	0.99
R7757:Irs2	UTSW	8	11006522	nonsense	probably null
R8347:Irs2	UTSW	8	11008000	missense	possibly damaging	0.82
R8348:Irs2	UTSW	8	11004974	missense	probably damaging	0.98
R8377:Irs2	UTSW	8	11004848	nonsense	probably null
R8444:Irs2	UTSW	8	11006683	missense	probably damaging	0.99
Z1176:Irs2	UTSW	8	11006185	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACGAAGTGCACTTGGCTGC -3'
(R):5'- CACCATCGGCTTCGTGAAG -3'

Sequencing Primer
(F):5'- CACTTGGCTGCTGGGGG -3'
(R):5'- CTTCGTGAAGCTCAATTGCGAAC -3'

Posted On

2014-08-25