Incidental Mutation 'R2042:Ipmk'
ID225100
Institutional Source Beutler Lab
Gene Symbol Ipmk
Ensembl Gene ENSMUSG00000060733
Gene Nameinositol polyphosphate multikinase
Synonyms
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location71347763-71433327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71363503 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 65 (R65W)
Ref Sequence ENSEMBL: ENSMUSP00000120073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079252] [ENSMUST00000118381] [ENSMUST00000121446] [ENSMUST00000147277]
Predicted Effect probably damaging
Transcript: ENSMUST00000079252
AA Change: R65W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078240
Gene: ENSMUSG00000060733
AA Change: R65W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 391 1.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118381
AA Change: R65W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113083
Gene: ENSMUSG00000060733
AA Change: R65W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 194 8.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121446
AA Change: R65W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112568
Gene: ENSMUSG00000060733
AA Change: R65W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 111 392 2.6e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141153
Predicted Effect probably damaging
Transcript: ENSMUST00000147277
AA Change: R65W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120073
Gene: ENSMUSG00000060733
AA Change: R65W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 194 8.2e-33 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein has 3-kinase, 5-kinase and 6-kinase activities on phosphorylated inositol substrates. The encoded protein plays an important role in the biosynthesis of inositol 1,3,4,5,6-pentakisphosphate, and has a preferred 5-kinase activity. This gene may play a role in nuclear mRNA export. Pseudogenes of this gene are located on the long arm of chromosome 13 and the short arm of chromosome 19. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryo size, delayed embryonic development, failure of chorioallantoic fusion and embryo turning, and a kinked and open neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Ipmk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ipmk APN 10 71376766 missense probably damaging 0.99
IGL01524:Ipmk APN 10 71372801 missense probably damaging 1.00
IGL01872:Ipmk APN 10 71372876 missense probably damaging 1.00
I1329:Ipmk UTSW 10 71381447 missense possibly damaging 0.46
R0282:Ipmk UTSW 10 71372831 missense probably benign 0.06
R1477:Ipmk UTSW 10 71381777 missense probably damaging 1.00
R1759:Ipmk UTSW 10 71381303 missense probably damaging 1.00
R2070:Ipmk UTSW 10 71372749 nonsense probably null
R2160:Ipmk UTSW 10 71381426 missense probably benign 0.00
R2520:Ipmk UTSW 10 71381217 missense probably damaging 1.00
R4570:Ipmk UTSW 10 71372739 missense probably benign 0.04
R5522:Ipmk UTSW 10 71363474 missense probably benign 0.30
R6941:Ipmk UTSW 10 71348090 missense probably null 1.00
R7198:Ipmk UTSW 10 71348052 missense probably damaging 1.00
R7203:Ipmk UTSW 10 71363468 missense possibly damaging 0.67
R7414:Ipmk UTSW 10 71381294 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCAGTAAAAGCTTTCCGTCTATG -3'
(R):5'- CTAACTTAGCATTTCTGAGAGTGAC -3'

Sequencing Primer
(F):5'- TCCGTCTATGAAAGAGGTTGCCC -3'
(R):5'- AGTGACAAACTCTCTCTGTTGAGTG -3'
Posted On2014-08-25