Mutagenetix > Incidental Mutation

Incidental Mutation 'R1991:Letm1'

225113

Institutional Source

Beutler Lab

Gene Symbol

Letm1

Ensembl Gene

ENSMUSG00000005299

Gene Name

leucine zipper-EF-hand containing transmembrane protein 1

Synonyms

MMRRC Submission

040002-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R1991 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

33739673-33782817 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

A to AG at 33769515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000005431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005431]

AlphaFold

Q9Z2I0

Predicted Effect

probably null
Transcript: ENSMUST00000005431

SMART Domains

Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299

Domain	Start	End	E-Value	Type
low complexity region	10	30	N/A	INTRINSIC
low complexity region	120	135	N/A	INTRINSIC
Pfam:LETM1	152	417	1.2e-111	PFAM
coiled coil region	445	493	N/A	INTRINSIC
low complexity region	503	513	N/A	INTRINSIC
coiled coil region	537	598	N/A	INTRINSIC
SCOP:d1c7va_	647	691	4e-3	SMART
coiled coil region	708	738	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144071

Predicted Effect

probably benign
Transcript: ENSMUST00000200827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201981

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (124/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,065,658	R203*	probably null	Het
Abcc2	A	T	19: 43,807,142	I446F	probably damaging	Het
Afap1l2	A	T	19: 57,002,267	I18N	possibly damaging	Het
Aida	A	T	1: 183,313,692	E107D	probably benign	Het
Amer2	A	G	14: 60,379,820	Y362C	probably damaging	Het
Amigo1	T	C	3: 108,187,328	S48P	probably benign	Het
Ano5	A	G	7: 51,537,813	K50R	possibly damaging	Het
Anxa2	A	T	9: 69,483,816	D95V	probably damaging	Het
Arhgap22	A	G	14: 33,366,959	N466D	probably damaging	Het
Armc3	T	C	2: 19,293,142	Y575H	probably damaging	Het
Ascc2	A	G	11: 4,679,257	E523G	probably benign	Het
B3galt5	A	T	16: 96,316,025	K286M	probably damaging	Het
Bag3	C	T	7: 128,545,683	H341Y	probably benign	Het
Blm	G	T	7: 80,505,949		probably null	Het
Cacna1b	G	A	2: 24,732,306	P222L	probably damaging	Het
Cap2	T	A	13: 46,637,881	Y175N	possibly damaging	Het
Cd81	G	T	7: 143,067,201	G206*	probably null	Het
Cep290	T	A	10: 100,531,184	S1132R	possibly damaging	Het
Cluh	C	A	11: 74,659,529	C222*	probably null	Het
Col14a1	A	T	15: 55,449,940	D1320V	unknown	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Cped1	A	G	6: 22,233,927	T847A	probably damaging	Het
Cpne7	A	G	8: 123,127,437	K288E	possibly damaging	Het
Cr2	G	A	1: 195,154,150	P1278S	possibly damaging	Het
Creb3	C	A	4: 43,565,327	R202S	probably damaging	Het
Cyp2j9	T	A	4: 96,571,964	K434M	probably damaging	Het
Dpp10	A	T	1: 123,905,106	V48E	probably null	Het
Dsg2	A	G	18: 20,601,473	K836R	probably damaging	Het
Dst	A	G	1: 34,190,258	T1986A	probably benign	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Ecm2	A	G	13: 49,530,256	D570G	probably benign	Het
Efhc1	T	A	1: 20,989,560	C611*	probably null	Het
Epop	T	C	11: 97,628,654	T210A	probably benign	Het
Erc2	A	G	14: 28,011,636	I556V	probably benign	Het
Fdxacb1	A	T	9: 50,771,646	N101I	probably benign	Het
Fhad1	T	C	4: 141,982,162	S294G	possibly damaging	Het
Galnt16	A	G	12: 80,583,656	D262G	probably damaging	Het
Gm9573	A	T	17: 35,618,708	S1529T	probably benign	Het
Gorab	A	G	1: 163,397,056	S59P	probably damaging	Het
Gpr161	G	T	1: 165,306,563	M131I	probably damaging	Het
Gpr22	T	A	12: 31,709,203	M270L	probably benign	Het
Grin3b	C	A	10: 79,970,912	Q5K	probably benign	Het
Grin3b	C	T	10: 79,974,646	A662V	probably damaging	Het
Gsdmc	A	G	15: 63,801,899	I179T	probably benign	Het
Gsdmc2	T	A	15: 63,828,237	M229L	probably benign	Het
H2-Eb2	A	G	17: 34,334,304	I155V	probably benign	Het
Hoga1	A	C	19: 42,060,020		probably null	Het
Hs3st5	A	G	10: 36,832,886	Y139C	probably damaging	Het
Il10ra	C	A	9: 45,255,811	A481S	probably benign	Het
Ints2	T	A	11: 86,248,934	H278L	possibly damaging	Het
Kalrn	T	G	16: 33,975,738	L1222F	probably damaging	Het
Klhl25	T	A	7: 75,866,732	V157D	probably damaging	Het
Klk1b26	A	T	7: 44,016,900	T256S	probably damaging	Het
Krt81	T	C	15: 101,462,554	Q184R	probably benign	Het
Lce1k	A	T	3: 92,806,818	C20S	unknown	Het
Lin54	A	G	5: 100,485,801		probably null	Het
Lrrc37a	T	C	11: 103,500,261	E1446G	probably benign	Het
Macf1	A	G	4: 123,456,695	S3792P	probably damaging	Het
Manba	T	A	3: 135,551,191	D538E	probably benign	Het
Mcc	C	A	18: 44,491,315	E213*	probably null	Het
Mfap4	T	C	11: 61,485,807		probably null	Het
Nebl	T	A	2: 17,452,510	I80F	probably damaging	Het
Nek4	A	G	14: 30,956,953	I145V	probably damaging	Het
Nlrp14	T	C	7: 107,196,200	V230A	probably benign	Het
Nxf3	G	A	X: 136,075,834	P380S	possibly damaging	Het
Olfr1451	T	C	19: 12,999,502	V172A	possibly damaging	Het
Olfr403	T	C	11: 74,196,163	V220A	probably damaging	Het
Olfr421-ps1	C	T	1: 174,152,121	H202Y	probably damaging	Het
Olfr490	C	A	7: 108,286,359	G256*	probably null	Het
Olfr745	G	A	14: 50,642,866	C195Y	possibly damaging	Het
Pcdhb13	C	T	18: 37,443,859	T430I	possibly damaging	Het
Piezo2	A	T	18: 63,074,662	L1426Q	probably null	Het
Pigk	T	A	3: 152,744,494	Y212N	probably damaging	Het
Pigm	T	G	1: 172,377,261	L188R	probably damaging	Het
Plce1	T	C	19: 38,777,924	F2117S	probably damaging	Het
Plec	A	G	15: 76,173,543	F4055L	probably damaging	Het
Plk5	C	T	10: 80,363,102	S435L	possibly damaging	Het
Pms1	G	A	1: 53,282,042	L11F	probably damaging	Het
Prl3b1	C	T	13: 27,247,912	T140I	possibly damaging	Het
Prl7a1	T	G	13: 27,633,672	D203A	probably damaging	Het
Psg17	A	G	7: 18,814,652	V398A	probably benign	Het
Pum1	T	A	4: 130,718,218	I166K	possibly damaging	Het
R3hdm1	T	A	1: 128,169,016	D108E	probably damaging	Het
Reln	A	T	5: 21,969,360	D1948E	possibly damaging	Het
Rnf112	C	T	11: 61,452,426	R141Q	probably damaging	Het
Rnf145	T	C	11: 44,561,466	V424A	possibly damaging	Het
Serpina3m	C	A	12: 104,389,699	Y208*	probably null	Het
Serpind1	T	C	16: 17,342,944	V446A	probably benign	Het
Shc3	T	A	13: 51,442,836	M384L	probably benign	Het
Slc38a11	A	G	2: 65,330,339	F304L	probably benign	Het
Slpi	C	T	2: 164,355,543	C28Y	probably damaging	Het
Specc1	C	A	11: 62,029,294	P7T	possibly damaging	Het
Spib	T	C	7: 44,528,857	E180G	probably benign	Het
Spint5	T	C	2: 164,716,983		probably benign	Het
Ssr2	T	A	3: 88,576,867		probably benign	Het
Tbrg1	T	C	9: 37,649,419	D387G	probably benign	Het
Tex14	T	G	11: 87,549,470	L1367R	probably damaging	Het
Tfpi	A	C	2: 84,458,016		probably benign	Het
Tlr5	T	A	1: 182,974,347	D405E	probably damaging	Het
Tnnt3	C	T	7: 142,511,525	R131C	possibly damaging	Het
Tnxb	T	C	17: 34,671,904	V407A	probably damaging	Het
Tnxb	A	G	17: 34,682,251	Y1013C	probably damaging	Het
Tpx2	T	A	2: 152,890,624	M606K	probably benign	Het
Trim30a	T	A	7: 104,430,230		probably benign	Het
Trim46	A	T	3: 89,237,701	Y489N	probably damaging	Het
Trpm6	A	T	19: 18,796,284	H380L	probably benign	Het
Tstd2	A	G	4: 46,120,563	I279T	probably benign	Het
Ttn	C	T	2: 76,946,391		probably null	Het
Txnl1	T	C	18: 63,679,514	T70A	probably benign	Het
Ush2a	C	T	1: 188,578,532		probably benign	Het
Usp1	A	G	4: 98,934,294	D615G	probably benign	Het
Virma	T	A	4: 11,519,242	C830S	probably benign	Het
Vmn1r7	A	T	6: 57,024,868	S136T	probably benign	Het
Vmn2r9	A	G	5: 108,846,439	V448A	probably damaging	Het
Vps11	G	A	9: 44,359,227	H183Y	probably damaging	Het
Vsig10l	A	G	7: 43,467,468	T476A	possibly damaging	Het
Wdr63	G	T	3: 146,063,480	T522K	possibly damaging	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt8a	A	G	18: 34,544,884	D115G	probably damaging	Het
Xndc1	T	A	7: 102,073,191	V21E	probably damaging	Het
Zc3hav1	C	A	6: 38,336,517	V198L	probably damaging	Het
Zfp874a	T	A	13: 67,442,504	I354F	probably benign	Het
Zfr2	A	T	10: 81,242,852	D306V	possibly damaging	Het

Other mutations in Letm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Letm1	APN	5	33762590	missense	possibly damaging	0.82
IGL01073:Letm1	APN	5	33748800	missense	possibly damaging	0.89
IGL01882:Letm1	APN	5	33769665	missense	probably benign	0.00
IGL02186:Letm1	APN	5	33745047	missense	probably benign	0.00
IGL02699:Letm1	APN	5	33745148	missense	possibly damaging	0.93
IGL03089:Letm1	APN	5	33760858	missense	probably damaging	1.00
R0466:Letm1	UTSW	5	33761730	splice site	probably benign
R0639:Letm1	UTSW	5	33769426	missense	possibly damaging	0.88
R1370:Letm1	UTSW	5	33778682	splice site	probably null
R1415:Letm1	UTSW	5	33769562	missense	probably benign	0.06
R1511:Letm1	UTSW	5	33752555	missense	probably damaging	1.00
R1714:Letm1	UTSW	5	33760884	missense	possibly damaging	0.51
R1771:Letm1	UTSW	5	33769467	missense	probably damaging	1.00
R1990:Letm1	UTSW	5	33769515	frame shift	probably null
R2143:Letm1	UTSW	5	33769515	frame shift	probably null
R2145:Letm1	UTSW	5	33769515	frame shift	probably null
R2202:Letm1	UTSW	5	33769486	missense	possibly damaging	0.64
R2290:Letm1	UTSW	5	33769515	frame shift	probably null
R2292:Letm1	UTSW	5	33769515	frame shift	probably null
R5574:Letm1	UTSW	5	33769386	missense	possibly damaging	0.46
R6954:Letm1	UTSW	5	33782507	missense	probably benign	0.35
R7265:Letm1	UTSW	5	33778648	missense	possibly damaging	0.62
R8713:Letm1	UTSW	5	33762505	missense	probably damaging	1.00
R9028:Letm1	UTSW	5	33752503	missense	probably damaging	1.00
R9061:Letm1	UTSW	5	33760869	missense	probably damaging	1.00
R9420:Letm1	UTSW	5	33769458	missense	probably damaging	1.00
S24628:Letm1	UTSW	5	33747444	missense	probably benign	0.00
S24628:Letm1	UTSW	5	33747446	missense	probably benign
X0066:Letm1	UTSW	5	33762571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTTTTATCCAGAGGAGTAGAGC -3'
(R):5'- AACATGGACACCTGCCTCTG -3'

Sequencing Primer
(F):5'- TTTATCCAGAGGAGTAGAGCATAACC -3'
(R):5'- CTCTGCAAGGCTGGTGGTTAC -3'

Posted On

2014-08-25