Incidental Mutation 'R2042:Pcnx'
ID225118
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81918293 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 411 (H411Q)
Ref Sequence ENSEMBL: ENSMUSP00000152302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably damaging
Transcript: ENSMUST00000021567
AA Change: H411Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: H411Q

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221675
Predicted Effect probably damaging
Transcript: ENSMUST00000221721
AA Change: H411Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222005
AA Change: H411Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- CCAGCCACCTACAAAGTGTG -3'
(R):5'- CAGTAAACTCATTTGCATGGGG -3'

Sequencing Primer
(F):5'- CTACAAAGTGTGGGAAGAGCAG -3'
(R):5'- TGCCTGAGCATCTGGAGC -3'
Posted On2014-08-25