Incidental Mutation 'R2042:Ahnak2'
ID225120
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112785819 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 176 (Y176F)
Ref Sequence ENSEMBL: ENSMUSP00000114522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124526]
Predicted Effect probably damaging
Transcript: ENSMUST00000124526
AA Change: Y176F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812
AA Change: Y176F

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137195
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Meta Mutation Damage Score 0.1421 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
R7508:Ahnak2 UTSW 12 112774405 missense possibly damaging 0.46
R7560:Ahnak2 UTSW 12 112779674 missense
R7611:Ahnak2 UTSW 12 112788129 missense
R7743:Ahnak2 UTSW 12 112784763 missense not run
R7762:Ahnak2 UTSW 12 112775680 missense probably benign 0.27
R7780:Ahnak2 UTSW 12 112782613 missense
R7930:Ahnak2 UTSW 12 112779125 missense
R7985:Ahnak2 UTSW 12 112778963 missense
R8114:Ahnak2 UTSW 12 112774729 missense probably benign 0.05
R8122:Ahnak2 UTSW 12 112776076 missense possibly damaging 0.83
R8240:Ahnak2 UTSW 12 112774648 missense probably benign 0.03
R8289:Ahnak2 UTSW 12 112775808 missense possibly damaging 0.46
R8315:Ahnak2 UTSW 12 112781133 missense
R8430:Ahnak2 UTSW 12 112774687 missense possibly damaging 0.86
R8476:Ahnak2 UTSW 12 112782991 unclassified probably benign
Z1177:Ahnak2 UTSW 12 112781199 missense
Predicted Primers PCR Primer
(F):5'- CACTGCACAGGAAAGAGATCTC -3'
(R):5'- TGGACTTTGCTCAGCCACTG -3'

Sequencing Primer
(F):5'- CTAGTGTAACCAGAGCCATCTTGG -3'
(R):5'- TGCTCAGCCACTGAAGATTG -3'
Posted On2014-08-25