Mutagenetix > Incidental Mutations

Incidental Mutation 'R2042:Slc4a7'

225126

Institutional Source

Beutler Lab

Gene Symbol

Slc4a7

Ensembl Gene

ENSMUSG00000021733

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter, member 7

Synonyms

NBC3, NBCn1, E430014N10Rik

MMRRC Submission

040049-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R2042 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14702279-14799940 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14737386 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 99 (V99M)

Ref Sequence

ENSEMBL: ENSMUSP00000153323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057015] [ENSMUST00000223607] [ENSMUST00000223695] [ENSMUST00000223740] [ENSMUST00000223761] [ENSMUST00000223981] [ENSMUST00000224049] [ENSMUST00000224222] [ENSMUST00000224333] [ENSMUST00000224672] [ENSMUST00000224752] [ENSMUST00000225232] [ENSMUST00000225238] [ENSMUST00000225175] [ENSMUST00000225630] [ENSMUST00000226079] [ENSMUST00000225979]

Predicted Effect

probably damaging
Transcript: ENSMUST00000057015
AA Change: V99M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000058313
Gene: ENSMUSG00000021733
AA Change: V99M

Domain	Start	End	E-Value	Type
low complexity region	57	89	N/A	INTRINSIC
Pfam:Band_3_cyto	146	413	1.4e-110	PFAM
Pfam:HCO3_cotransp	456	969	1.6e-242	PFAM
transmembrane domain	977	999	N/A	INTRINSIC
coiled coil region	1021	1050	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223607
AA Change: V99M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223695
AA Change: V105M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223740
AA Change: V105M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223761
AA Change: V99M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223981
AA Change: V99M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224049
AA Change: V105M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224222
AA Change: V99M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224333
AA Change: V105M

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224672
AA Change: V105M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224752
AA Change: V104M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

unknown
Transcript: ENSMUST00000224952
AA Change: V118M

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225078

Predicted Effect

probably damaging
Transcript: ENSMUST00000225232
AA Change: V99M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225238
AA Change: V99M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225175
AA Change: V99M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225630
AA Change: V99M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000226079
AA Change: V99M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225979
AA Change: V99M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225496

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sodium bicarbonate cotransporter. The encoded transmembrane protein appears to transport sodium and bicarbonate ions in a 1:1 ratio, and is thus considered an electroneutral cotransporter. The encoded protein likely plays a critical role in regulation of intracellular pH involved in visual and auditory sensory transmission. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a disruption at this locus display defects of the auditory and visual systems similar to those observed in patients with Ushers syndrome. Mice homozygous for a gene trap allele exhibit disruption in sodium/bicarbonate function that impacts vasodilation and hypertension. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	A	3: 124,416,728		probably benign	Het
9130019O22Rik	A	T	7: 127,385,469	C154S	possibly damaging	Het
Abca16	G	A	7: 120,544,718	R1653Q	probably benign	Het
Ahnak2	T	A	12: 112,785,819	Y176F	probably damaging	Het
Ano6	T	C	15: 95,956,023		probably null	Het
Atr	T	C	9: 95,870,022	L564S	probably benign	Het
Birc6	C	G	17: 74,609,659	A1774G	probably damaging	Het
Cacng1	C	T	11: 107,704,308	A148T	probably damaging	Het
Cd53	T	A	3: 106,767,424		probably null	Het
Celsr2	A	G	3: 108,402,495	F1596S	probably damaging	Het
Cep120	A	T	18: 53,735,742	F122I	possibly damaging	Het
Ckm	A	T	7: 19,414,157	H7L	possibly damaging	Het
Crybg2	T	C	4: 134,087,533	V1575A	possibly damaging	Het
Cspp1	A	G	1: 10,112,538	E712G	probably damaging	Het
Cyp2b23	C	A	7: 26,666,108	R434L	probably damaging	Het
D630003M21Rik	A	T	2: 158,215,849	S570T	probably damaging	Het
Dmbt1	A	G	7: 131,106,359	I1444V	probably damaging	Het
Dnah8	T	C	17: 30,635,658	V98A	probably benign	Het
Dtx1	T	G	5: 120,694,476	N299T	probably benign	Het
Efr3b	T	A	12: 3,984,627	D65V	probably damaging	Het
Eml4	T	C	17: 83,448,178	C323R	probably damaging	Het
Eps15	C	T	4: 109,304,767	T31I	probably damaging	Het
Fam160a2	G	T	7: 105,384,121	Y629*	probably null	Het
Fam205c	C	T	4: 42,874,030	C46Y	possibly damaging	Het
Fam46b	T	C	4: 133,486,613	V265A	possibly damaging	Het
Fam91a1	A	G	15: 58,426,594	I184V	probably benign	Het
Fbxl8	A	T	8: 105,268,224	I123F	probably damaging	Het
Fbxw26	T	G	9: 109,732,704	T141P	probably damaging	Het
Glra3	G	A	8: 56,062,459	D190N	probably benign	Het
Hspg2	T	C	4: 137,568,366	L4229P	probably damaging	Het
Ipmk	C	T	10: 71,363,503	R65W	probably damaging	Het
Irs2	A	G	8: 11,007,580	I284T	probably damaging	Het
Klhl22	T	C	16: 17,792,420		probably benign	Het
Lmcd1	T	A	6: 112,315,890	D234E	probably benign	Het
Lrrc14b	T	C	13: 74,363,442	K173R	probably benign	Het
Magi1	A	T	6: 93,755,045	N209K	probably benign	Het
Mak	A	C	13: 41,049,436	S179A	possibly damaging	Het
Map3k4	C	A	17: 12,277,983	R87L	probably damaging	Het
Map4k1	T	C	7: 28,984,130	L53P	probably damaging	Het
Melk	T	C	4: 44,309,051		probably null	Het
Mks1	C	T	11: 87,856,668		probably benign	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
N4bp2	C	T	5: 65,826,621	P1670S	probably damaging	Het
Ncf1	C	G	5: 134,226,640	Q132H	probably benign	Het
Nemp1	T	C	10: 127,696,334	S370P	possibly damaging	Het
Nt5c3b	T	C	11: 100,436,194	H92R	probably benign	Het
Olfr1180	G	A	2: 88,412,202	A152V	possibly damaging	Het
Olfr527	T	C	7: 140,335,937	L25P	probably damaging	Het
P4ha3	T	C	7: 100,300,690		probably null	Het
Pcnx	C	A	12: 81,918,293	H411Q	probably damaging	Het
Podxl	A	G	6: 31,523,116	V473A	possibly damaging	Het
Prkd2	T	C	7: 16,856,268	S530P	possibly damaging	Het
Scin	A	G	12: 40,077,510	I427T	possibly damaging	Het
Sgo2b	T	C	8: 63,928,527	T424A	probably benign	Het
Slc22a2	T	C	17: 12,599,125	I196T	probably benign	Het
Slc47a2	C	A	11: 61,338,082	V90L	probably benign	Het
Sprr2k	T	C	3: 92,433,456		probably benign	Het
Spta1	G	A	1: 174,211,647	M1185I	probably benign	Het
Uaca	T	C	9: 60,869,891	V518A	probably damaging	Het
Ubr3	C	T	2: 69,977,774	Q1200*	probably null	Het
Ufm1	A	G	3: 53,859,281		probably benign	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp142	G	A	1: 74,570,619	T1236I	probably benign	Het
Zfp236	A	G	18: 82,633,109	Y845H	probably damaging	Het
Zfp787	T	C	7: 6,132,764	K163E	possibly damaging	Het

Other mutations in Slc4a7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00974:Slc4a7	APN	14	14760292	missense	probably benign	0.18
IGL01468:Slc4a7	APN	14	14737480	missense	probably damaging	1.00
IGL01863:Slc4a7	APN	14	14762430	missense	probably damaging	0.97
IGL03122:Slc4a7	APN	14	14782040	splice site	probably benign
R0020:Slc4a7	UTSW	14	14796108	missense	probably benign
R0403:Slc4a7	UTSW	14	14766808	missense	probably benign	0.02
R0410:Slc4a7	UTSW	14	14738299	missense	probably damaging	1.00
R0624:Slc4a7	UTSW	14	14794059	critical splice donor site	probably null
R0631:Slc4a7	UTSW	14	14757382	missense	probably damaging	1.00
R1128:Slc4a7	UTSW	14	14733832	missense	probably damaging	1.00
R1556:Slc4a7	UTSW	14	14778872	missense	probably benign	0.01
R1672:Slc4a7	UTSW	14	14760247	missense	possibly damaging	0.91
R1711:Slc4a7	UTSW	14	14765709	missense	probably benign	0.45
R1870:Slc4a7	UTSW	14	14737509	critical splice donor site	probably null
R1939:Slc4a7	UTSW	14	14748581	missense	probably damaging	1.00
R2012:Slc4a7	UTSW	14	14733727	nonsense	probably null
R2064:Slc4a7	UTSW	14	14733773	missense	probably damaging	1.00
R2404:Slc4a7	UTSW	14	14733733	missense	probably damaging	1.00
R2880:Slc4a7	UTSW	14	14773277	missense	probably damaging	1.00
R3729:Slc4a7	UTSW	14	14729276	missense	probably damaging	1.00
R4368:Slc4a7	UTSW	14	14733775	missense	probably damaging	1.00
R4395:Slc4a7	UTSW	14	14765665	missense	probably damaging	1.00
R4432:Slc4a7	UTSW	14	14757323	missense	probably damaging	1.00
R4592:Slc4a7	UTSW	14	14778850	missense	probably damaging	1.00
R4705:Slc4a7	UTSW	14	14733856	missense	probably damaging	1.00
R4743:Slc4a7	UTSW	14	14796073	splice site	probably null
R4765:Slc4a7	UTSW	14	14762414	missense	probably damaging	1.00
R4831:Slc4a7	UTSW	14	14772699	critical splice donor site	probably null
R4845:Slc4a7	UTSW	14	14733803	missense	probably damaging	1.00
R4880:Slc4a7	UTSW	14	14757342	missense	probably damaging	1.00
R4948:Slc4a7	UTSW	14	14771283	missense	possibly damaging	0.68
R5348:Slc4a7	UTSW	14	14786310	missense	probably benign	0.02
R5385:Slc4a7	UTSW	14	14773345	missense	possibly damaging	0.94
R5418:Slc4a7	UTSW	14	14760280	missense	probably benign	0.25
R5480:Slc4a7	UTSW	14	14782138	missense	probably damaging	1.00
R5842:Slc4a7	UTSW	14	14778866	missense	probably damaging	1.00
R5919:Slc4a7	UTSW	14	14791092	missense	probably benign
R6063:Slc4a7	UTSW	14	14793964	missense	possibly damaging	0.60
R6065:Slc4a7	UTSW	14	14739836	missense	probably benign	0.29
R6549:Slc4a7	UTSW	14	14748564	missense	probably damaging	1.00
R6845:Slc4a7	UTSW	14	14775000	missense	probably damaging	1.00
R6870:Slc4a7	UTSW	14	14733846	missense	probably damaging	1.00
R6881:Slc4a7	UTSW	14	14737452	missense	probably benign	0.43
R6962:Slc4a7	UTSW	14	14746021	missense	probably damaging	0.99
R7099:Slc4a7	UTSW	14	14733750	missense	probably damaging	1.00
R7180:Slc4a7	UTSW	14	14765580	missense	probably damaging	1.00
R7346:Slc4a7	UTSW	14	14775000	missense	probably damaging	1.00
R7378:Slc4a7	UTSW	14	14757421	missense	probably damaging	1.00
R7646:Slc4a7	UTSW	14	14773348	missense	probably benign	0.01
R7647:Slc4a7	UTSW	14	14773348	missense	probably benign	0.01
R7648:Slc4a7	UTSW	14	14773348	missense	probably benign	0.01
R7650:Slc4a7	UTSW	14	14773348	missense	probably benign	0.01
R7857:Slc4a7	UTSW	14	14772624	missense	probably benign	0.00
R7892:Slc4a7	UTSW	14	14773348	missense	probably benign	0.01
R8124:Slc4a7	UTSW	14	14729211	missense	possibly damaging	0.92
R8225:Slc4a7	UTSW	14	14738224	nonsense	probably null
R8354:Slc4a7	UTSW	14	14786313	missense	probably damaging	1.00
X0067:Slc4a7	UTSW	14	14771276	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CTTGTACATGTTGGAAGCTTGAAG -3'
(R):5'- ATCACCAACTGCATCTTGTACT -3'

Sequencing Primer
(F):5'- TCCAGGACTTCCCATGCAG -3'
(R):5'- CCAACTGCATCTTGTACTTAAAAGC -3'

Posted On

2014-08-25