Mutagenetix > Incidental Mutations

Incidental Mutation 'R2042:Ano6'

225132

Institutional Source

Beutler Lab

Gene Symbol

Ano6

Ensembl Gene

ENSMUSG00000064210

Gene Name

anoctamin 6

Synonyms

Tmem16f, 2900059G15Rik, F730003B03Rik

MMRRC Submission

040049-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.457) question?

Stock #

R2042 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95790843-95974751 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 95956023 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153954 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]

Predicted Effect

probably null
Transcript: ENSMUST00000071874

SMART Domains

Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210

Domain	Start	End	E-Value	Type
low complexity region	9	27	N/A	INTRINSIC
Pfam:Anoct_dimer	63	285	4.5e-70	PFAM
Pfam:Anoctamin	288	872	3.3e-137	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000227151

Predicted Effect

probably null
Transcript: ENSMUST00000227791

Meta Mutation Damage Score

0.9502

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	A	3: 124,416,728		probably benign	Het
9130019O22Rik	A	T	7: 127,385,469	C154S	possibly damaging	Het
Abca16	G	A	7: 120,544,718	R1653Q	probably benign	Het
Ahnak2	T	A	12: 112,785,819	Y176F	probably damaging	Het
Atr	T	C	9: 95,870,022	L564S	probably benign	Het
Birc6	C	G	17: 74,609,659	A1774G	probably damaging	Het
Cacng1	C	T	11: 107,704,308	A148T	probably damaging	Het
Cd53	T	A	3: 106,767,424		probably null	Het
Celsr2	A	G	3: 108,402,495	F1596S	probably damaging	Het
Cep120	A	T	18: 53,735,742	F122I	possibly damaging	Het
Ckm	A	T	7: 19,414,157	H7L	possibly damaging	Het
Crybg2	T	C	4: 134,087,533	V1575A	possibly damaging	Het
Cspp1	A	G	1: 10,112,538	E712G	probably damaging	Het
Cyp2b23	C	A	7: 26,666,108	R434L	probably damaging	Het
D630003M21Rik	A	T	2: 158,215,849	S570T	probably damaging	Het
Dmbt1	A	G	7: 131,106,359	I1444V	probably damaging	Het
Dnah8	T	C	17: 30,635,658	V98A	probably benign	Het
Dtx1	T	G	5: 120,694,476	N299T	probably benign	Het
Efr3b	T	A	12: 3,984,627	D65V	probably damaging	Het
Eml4	T	C	17: 83,448,178	C323R	probably damaging	Het
Eps15	C	T	4: 109,304,767	T31I	probably damaging	Het
Fam160a2	G	T	7: 105,384,121	Y629*	probably null	Het
Fam205c	C	T	4: 42,874,030	C46Y	possibly damaging	Het
Fam46b	T	C	4: 133,486,613	V265A	possibly damaging	Het
Fam91a1	A	G	15: 58,426,594	I184V	probably benign	Het
Fbxl8	A	T	8: 105,268,224	I123F	probably damaging	Het
Fbxw26	T	G	9: 109,732,704	T141P	probably damaging	Het
Glra3	G	A	8: 56,062,459	D190N	probably benign	Het
Hspg2	T	C	4: 137,568,366	L4229P	probably damaging	Het
Ipmk	C	T	10: 71,363,503	R65W	probably damaging	Het
Irs2	A	G	8: 11,007,580	I284T	probably damaging	Het
Klhl22	T	C	16: 17,792,420		probably benign	Het
Lmcd1	T	A	6: 112,315,890	D234E	probably benign	Het
Lrrc14b	T	C	13: 74,363,442	K173R	probably benign	Het
Magi1	A	T	6: 93,755,045	N209K	probably benign	Het
Mak	A	C	13: 41,049,436	S179A	possibly damaging	Het
Map3k4	C	A	17: 12,277,983	R87L	probably damaging	Het
Map4k1	T	C	7: 28,984,130	L53P	probably damaging	Het
Melk	T	C	4: 44,309,051		probably null	Het
Mks1	C	T	11: 87,856,668		probably benign	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
N4bp2	C	T	5: 65,826,621	P1670S	probably damaging	Het
Ncf1	C	G	5: 134,226,640	Q132H	probably benign	Het
Nemp1	T	C	10: 127,696,334	S370P	possibly damaging	Het
Nt5c3b	T	C	11: 100,436,194	H92R	probably benign	Het
Olfr1180	G	A	2: 88,412,202	A152V	possibly damaging	Het
Olfr527	T	C	7: 140,335,937	L25P	probably damaging	Het
P4ha3	T	C	7: 100,300,690		probably null	Het
Pcnx	C	A	12: 81,918,293	H411Q	probably damaging	Het
Podxl	A	G	6: 31,523,116	V473A	possibly damaging	Het
Prkd2	T	C	7: 16,856,268	S530P	possibly damaging	Het
Scin	A	G	12: 40,077,510	I427T	possibly damaging	Het
Sgo2b	T	C	8: 63,928,527	T424A	probably benign	Het
Slc22a2	T	C	17: 12,599,125	I196T	probably benign	Het
Slc47a2	C	A	11: 61,338,082	V90L	probably benign	Het
Slc4a7	G	A	14: 14,737,386	V99M	probably damaging	Het
Sprr2k	T	C	3: 92,433,456		probably benign	Het
Spta1	G	A	1: 174,211,647	M1185I	probably benign	Het
Uaca	T	C	9: 60,869,891	V518A	probably damaging	Het
Ubr3	C	T	2: 69,977,774	Q1200*	probably null	Het
Ufm1	A	G	3: 53,859,281		probably benign	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp142	G	A	1: 74,570,619	T1236I	probably benign	Het
Zfp236	A	G	18: 82,633,109	Y845H	probably damaging	Het
Zfp787	T	C	7: 6,132,764	K163E	possibly damaging	Het

Other mutations in Ano6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Ano6	APN	15	95948429	missense	probably damaging	1.00
IGL01308:Ano6	APN	15	95913661	splice site	probably null
IGL01490:Ano6	APN	15	95948410	missense	probably benign	0.08
IGL01663:Ano6	APN	15	95967614	splice site	probably null
IGL01783:Ano6	APN	15	95962262	missense	possibly damaging	0.94
IGL02040:Ano6	APN	15	95955944	missense	probably benign	0.00
IGL02114:Ano6	APN	15	95943460	missense	probably damaging	0.96
IGL02683:Ano6	APN	15	95948312	missense	probably damaging	1.00
IGL03297:Ano6	APN	15	95962277	missense	probably damaging	1.00
IGL03401:Ano6	APN	15	95949905	missense	probably damaging	1.00
R0730:Ano6	UTSW	15	95920371	missense	probably damaging	1.00
R1086:Ano6	UTSW	15	95949962	splice site	probably null
R1264:Ano6	UTSW	15	95949566	missense	probably damaging	1.00
R1421:Ano6	UTSW	15	95913385	missense	probably benign	0.13
R1494:Ano6	UTSW	15	95972507	missense	probably damaging	0.98
R1755:Ano6	UTSW	15	95972570	missense	possibly damaging	0.74
R1757:Ano6	UTSW	15	95962267	missense	probably damaging	1.00
R2393:Ano6	UTSW	15	95966025	critical splice donor site	probably benign
R2415:Ano6	UTSW	15	95962280	missense	probably damaging	1.00
R2483:Ano6	UTSW	15	95965974	missense	probably benign	0.00
R2879:Ano6	UTSW	15	95943427	nonsense	probably null
R3440:Ano6	UTSW	15	95967721	missense	probably damaging	1.00
R3716:Ano6	UTSW	15	95913379	missense	probably damaging	1.00
R3717:Ano6	UTSW	15	95913379	missense	probably damaging	1.00
R3718:Ano6	UTSW	15	95913379	missense	probably damaging	1.00
R3887:Ano6	UTSW	15	95894449	missense	possibly damaging	0.64
R4175:Ano6	UTSW	15	95962169	missense	probably damaging	1.00
R4214:Ano6	UTSW	15	95965909	missense	probably benign
R4591:Ano6	UTSW	15	95943427	nonsense	probably null
R5249:Ano6	UTSW	15	95913588	missense	probably benign	0.35
R5383:Ano6	UTSW	15	95916037	missense	probably benign	0.00
R5496:Ano6	UTSW	15	95967614	splice site	probably null
R5532:Ano6	UTSW	15	95962241	missense	probably damaging	1.00
R5598:Ano6	UTSW	15	95941347	missense	probably damaging	1.00
R5645:Ano6	UTSW	15	95920351	missense	probably benign	0.03
R5739:Ano6	UTSW	15	95913379	missense	probably damaging	1.00
R5794:Ano6	UTSW	15	95894524	missense	probably benign	0.00
R5864:Ano6	UTSW	15	95920380	critical splice donor site	probably null
R5936:Ano6	UTSW	15	95972601	missense	probably damaging	1.00
R5937:Ano6	UTSW	15	95913957	missense	probably damaging	0.98
R6063:Ano6	UTSW	15	95948417	missense	probably damaging	1.00
R6191:Ano6	UTSW	15	95948499	critical splice donor site	probably null
R6275:Ano6	UTSW	15	95913433	missense	probably damaging	1.00
R6349:Ano6	UTSW	15	95966022	missense	probably damaging	0.97
R6468:Ano6	UTSW	15	95967714	missense	probably benign	0.01
R6734:Ano6	UTSW	15	95949536	missense	probably damaging	0.99
R6830:Ano6	UTSW	15	95894461	missense	probably damaging	1.00
R6883:Ano6	UTSW	15	95962111	missense	probably damaging	1.00
R6892:Ano6	UTSW	15	95967624	missense	probably damaging	1.00
R7171:Ano6	UTSW	15	95920291	missense	probably damaging	1.00
R7271:Ano6	UTSW	15	95913900	missense	probably damaging	1.00
R7284:Ano6	UTSW	15	95948303	missense	probably damaging	1.00
R7326:Ano6	UTSW	15	95864244	missense	possibly damaging	0.95
R7937:Ano6	UTSW	15	95972589	missense	probably damaging	1.00
R7944:Ano6	UTSW	15	95941309	missense	probably damaging	1.00
R7945:Ano6	UTSW	15	95941309	missense	probably damaging	1.00
R7954:Ano6	UTSW	15	95965821	missense	possibly damaging	0.93
R8496:Ano6	UTSW	15	95949926	missense	probably damaging	1.00
X0066:Ano6	UTSW	15	95943434	missense	probably damaging	0.99
Z1176:Ano6	UTSW	15	95913460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCAGGGTCTGACAGTGTG -3'
(R):5'- GGAAAATCCCATCTCATTGCC -3'

Sequencing Primer
(F):5'- CAGGGTCTGACAGTGTGTGTTC -3'
(R):5'- CATTGCCCAGTAATAAATCCTTAGC -3'

Posted On

2014-08-25