Incidental Mutation 'R2042:Klhl22'
ID225136
Institutional Source Beutler Lab
Gene Symbol Klhl22
Ensembl Gene ENSMUSG00000022750
Gene Namekelch-like 22
SynonymsKelchl, 2610318I18Rik
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R2042 (G1)
Quality Score213
Status Validated
Chromosome16
Chromosomal Location17759618-17793382 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 17792420 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012161] [ENSMUST00000117192] [ENSMUST00000120488] [ENSMUST00000165790] [ENSMUST00000232577]
Predicted Effect probably benign
Transcript: ENSMUST00000012161
SMART Domains Protein: ENSMUSP00000012161
Gene: ENSMUSG00000012017

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 71 102 4.56e0 SMART
EGF 113 145 2.43e1 SMART
EGF 147 174 2.03e1 SMART
EGF_like 207 233 1.68e0 SMART
EGF 235 262 1.73e1 SMART
EGF_like 309 352 2.86e1 SMART
EGF_like 323 364 4.97e0 SMART
EGF_like 367 407 8.13e-1 SMART
low complexity region 437 459 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 597 606 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
low complexity region 636 656 N/A INTRINSIC
low complexity region 665 685 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117192
SMART Domains Protein: ENSMUSP00000114115
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120488
SMART Domains Protein: ENSMUSP00000112412
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165790
SMART Domains Protein: ENSMUSP00000127227
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231329
Predicted Effect probably benign
Transcript: ENSMUST00000232577
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Klhl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Klhl22 APN 16 17776462 missense probably benign 0.03
IGL01973:Klhl22 APN 16 17792711 missense probably benign 0.00
IGL02115:Klhl22 APN 16 17776595 missense probably damaging 0.99
IGL02383:Klhl22 APN 16 17776898 missense possibly damaging 0.60
IGL03381:Klhl22 APN 16 17792727 missense possibly damaging 0.71
R0562:Klhl22 UTSW 16 17792624 missense probably benign
R0811:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R0812:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R1661:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1665:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1732:Klhl22 UTSW 16 17777024 missense probably damaging 1.00
R1902:Klhl22 UTSW 16 17771787 missense probably damaging 1.00
R2083:Klhl22 UTSW 16 17776525 missense probably benign
R4368:Klhl22 UTSW 16 17789273 missense possibly damaging 0.94
R4860:Klhl22 UTSW 16 17777016 synonymous silent
R6413:Klhl22 UTSW 16 17789317 missense probably benign 0.01
R7031:Klhl22 UTSW 16 17777026 missense probably damaging 1.00
R7095:Klhl22 UTSW 16 17792750 missense probably damaging 0.98
R7378:Klhl22 UTSW 16 17776805 missense probably damaging 1.00
R7565:Klhl22 UTSW 16 17789284 missense probably damaging 1.00
R8051:Klhl22 UTSW 16 17792579 missense probably damaging 0.99
R8153:Klhl22 UTSW 16 17792550 missense probably damaging 0.99
Z1088:Klhl22 UTSW 16 17776543 missense possibly damaging 0.86
Z1176:Klhl22 UTSW 16 17776696 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCCGCTCCAGCCTTTCAAAG -3'
(R):5'- AGCAGTCTTTCTCCATGTCGTAG -3'

Sequencing Primer
(F):5'- CCTTTCAAAGGGAGAGAAGCAG -3'
(R):5'- AGATGTGCACGTAGCCTGTAC -3'
Posted On2014-08-25