Incidental Mutation 'R0144:Fig4'
ID22514
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene NameFIG4 phosphoinositide 5-phosphatase
SynonymsA530089I17Rik
MMRRC Submission 038429-MU
Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585

Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R0144 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location41188172-41303260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41258049 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 413 (Y413H)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
Predicted Effect probably damaging
Transcript: ENSMUST00000043814
AA Change: Y413H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: Y413H

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Meta Mutation Damage Score 0.8035 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41251788 missense probably damaging 0.99
IGL01013:Fig4 APN 10 41267786 missense probably benign 0.00
IGL01066:Fig4 APN 10 41285417 splice site probably benign
IGL01501:Fig4 APN 10 41270374 missense probably benign
IGL01503:Fig4 APN 10 41256518 missense probably benign 0.00
IGL01535:Fig4 APN 10 41256494 missense probably benign 0.00
IGL01733:Fig4 APN 10 41277393 missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41270400 missense probably benign 0.18
IGL01866:Fig4 APN 10 41232164 missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41228112 missense probably benign 0.03
IGL01966:Fig4 APN 10 41232102 splice site probably null
IGL02032:Fig4 APN 10 41303006 missense probably benign 0.00
IGL02225:Fig4 APN 10 41256452 missense probably benign
IGL02345:Fig4 APN 10 41267774 missense probably null 1.00
IGL02532:Fig4 APN 10 41285281 splice site probably benign
IGL02686:Fig4 APN 10 41264004 missense probably damaging 0.99
IGL02965:Fig4 APN 10 41285665 missense probably damaging 0.98
P0021:Fig4 UTSW 10 41251825 missense probably damaging 1.00
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0117:Fig4 UTSW 10 41230041 nonsense probably null
R0655:Fig4 UTSW 10 41285677 missense probably damaging 1.00
R0701:Fig4 UTSW 10 41240512 nonsense probably null
R0751:Fig4 UTSW 10 41272982 missense probably damaging 1.00
R1540:Fig4 UTSW 10 41188586 missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41265427 missense probably damaging 0.99
R2916:Fig4 UTSW 10 41258075 missense probably damaging 0.98
R3927:Fig4 UTSW 10 41263139 missense probably benign
R4304:Fig4 UTSW 10 41256427 missense probably benign 0.01
R4586:Fig4 UTSW 10 41188632 missense probably damaging 1.00
R4678:Fig4 UTSW 10 41272998 missense probably benign 0.27
R4858:Fig4 UTSW 10 41233590 missense probably benign 0.00
R5614:Fig4 UTSW 10 41272985 missense probably damaging 0.98
R5896:Fig4 UTSW 10 41254885 missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41265447 missense probably damaging 0.99
R7056:Fig4 UTSW 10 41220932 missense probably benign 0.09
R7350:Fig4 UTSW 10 41251756 missense probably benign 0.03
R7452:Fig4 UTSW 10 41240637 missense possibly damaging 0.88
R7481:Fig4 UTSW 10 41230005 critical splice donor site probably null
R7610:Fig4 UTSW 10 41253713 missense probably damaging 1.00
R7818:Fig4 UTSW 10 41263166 missense probably damaging 0.98
R7830:Fig4 UTSW 10 41256466 missense probably benign 0.00
Z1088:Fig4 UTSW 10 41253731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACCTTTCAGGGGAAACCTGAC -3'
(R):5'- GCTGACCCTCACTCTGTGAAGATG -3'

Sequencing Primer
(F):5'- GGAAACCTGACACCTGCTG -3'
(R):5'- tgtgggtgctgggaattg -3'
Posted On2013-04-16