Incidental Mutation 'R2042:Birc6'
ID 225146
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Name baculoviral IAP repeat-containing 6
Synonyms D630005A10Rik, A430032G04Rik, apollon, Bruce, A430040A19Rik
MMRRC Submission 040049-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2042 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 74835290-75010351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 74916654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 1774 (A1774G)
Ref Sequence ENSEMBL: ENSMUSP00000138333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182944] [ENSMUST00000183224] [ENSMUST00000182845] [ENSMUST00000182278]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000177957
AA Change: A467G
Predicted Effect probably damaging
Transcript: ENSMUST00000180037
AA Change: A1774G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: A1774G

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181387
Predicted Effect probably damaging
Transcript: ENSMUST00000182133
AA Change: A1774G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: A1774G

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182221
Predicted Effect probably damaging
Transcript: ENSMUST00000182597
AA Change: A1774G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: A1774G

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182944
AA Change: A1770G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: A1770G

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183224
AA Change: A1760G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: A1760G

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182323
Predicted Effect probably benign
Transcript: ENSMUST00000182845
SMART Domains Protein: ENSMUSP00000138717
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 166 171 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
low complexity region 315 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182278
SMART Domains Protein: ENSMUSP00000138343
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 79 84 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
low complexity region 222 243 N/A INTRINSIC
Meta Mutation Damage Score 0.1380 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,210,377 (GRCm39) probably benign Het
Abca16 G A 7: 120,143,941 (GRCm39) R1653Q probably benign Het
Ahnak2 T A 12: 112,749,439 (GRCm39) Y176F probably damaging Het
Ano6 T C 15: 95,853,904 (GRCm39) probably null Het
Atr T C 9: 95,752,075 (GRCm39) L564S probably benign Het
Cacng1 C T 11: 107,595,134 (GRCm39) A148T probably damaging Het
Cd53 T A 3: 106,674,740 (GRCm39) probably null Het
Celsr2 A G 3: 108,309,811 (GRCm39) F1596S probably damaging Het
Cep120 A T 18: 53,868,814 (GRCm39) F122I possibly damaging Het
Ckm A T 7: 19,148,082 (GRCm39) H7L possibly damaging Het
Crybg2 T C 4: 133,814,844 (GRCm39) V1575A possibly damaging Het
Cspp1 A G 1: 10,182,763 (GRCm39) E712G probably damaging Het
Cyp2b23 C A 7: 26,365,533 (GRCm39) R434L probably damaging Het
D630003M21Rik A T 2: 158,057,769 (GRCm39) S570T probably damaging Het
Dmbt1 A G 7: 130,708,089 (GRCm39) I1444V probably damaging Het
Dnah8 T C 17: 30,854,632 (GRCm39) V98A probably benign Het
Dtx1 T G 5: 120,832,541 (GRCm39) N299T probably benign Het
Efr3b T A 12: 4,034,627 (GRCm39) D65V probably damaging Het
Eml4 T C 17: 83,755,607 (GRCm39) C323R probably damaging Het
Eps15 C T 4: 109,161,964 (GRCm39) T31I probably damaging Het
Fam91a1 A G 15: 58,298,443 (GRCm39) I184V probably benign Het
Fbxl8 A T 8: 105,994,856 (GRCm39) I123F probably damaging Het
Fbxw26 T G 9: 109,561,772 (GRCm39) T141P probably damaging Het
Fhip1b G T 7: 105,033,328 (GRCm39) Y629* probably null Het
Glra3 G A 8: 56,515,494 (GRCm39) D190N probably benign Het
Hspg2 T C 4: 137,295,677 (GRCm39) L4229P probably damaging Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Irs2 A G 8: 11,057,580 (GRCm39) I284T probably damaging Het
Klhl22 T C 16: 17,610,284 (GRCm39) probably benign Het
Lmcd1 T A 6: 112,292,851 (GRCm39) D234E probably benign Het
Lrrc14b T C 13: 74,511,561 (GRCm39) K173R probably benign Het
Magi1 A T 6: 93,732,026 (GRCm39) N209K probably benign Het
Mak A C 13: 41,202,912 (GRCm39) S179A possibly damaging Het
Map3k4 C A 17: 12,496,870 (GRCm39) R87L probably damaging Het
Map4k1 T C 7: 28,683,555 (GRCm39) L53P probably damaging Het
Melk T C 4: 44,309,051 (GRCm39) probably null Het
Mks1 C T 11: 87,747,494 (GRCm39) probably benign Het
Mrgpra2b C T 7: 47,113,908 (GRCm39) V249I probably benign Het
N4bp2 C T 5: 65,983,964 (GRCm39) P1670S probably damaging Het
Ncf1 C G 5: 134,255,494 (GRCm39) Q132H probably benign Het
Nemp1 T C 10: 127,532,203 (GRCm39) S370P possibly damaging Het
Nt5c3b T C 11: 100,327,020 (GRCm39) H92R probably benign Het
Or12j2 T C 7: 139,915,850 (GRCm39) L25P probably damaging Het
Or4p19 G A 2: 88,242,546 (GRCm39) A152V possibly damaging Het
P4ha3 T C 7: 99,949,897 (GRCm39) probably null Het
Pcnx1 C A 12: 81,965,067 (GRCm39) H411Q probably damaging Het
Podxl A G 6: 31,500,051 (GRCm39) V473A possibly damaging Het
Prkd2 T C 7: 16,590,193 (GRCm39) S530P possibly damaging Het
Scin A G 12: 40,127,509 (GRCm39) I427T possibly damaging Het
Sgo2b T C 8: 64,381,561 (GRCm39) T424A probably benign Het
Slc22a2 T C 17: 12,818,012 (GRCm39) I196T probably benign Het
Slc47a2 C A 11: 61,228,908 (GRCm39) V90L probably benign Het
Slc4a7 G A 14: 14,737,386 (GRCm38) V99M probably damaging Het
Spata31f3 C T 4: 42,874,030 (GRCm39) C46Y possibly damaging Het
Sprr2k T C 3: 92,340,763 (GRCm39) probably benign Het
Spta1 G A 1: 174,039,213 (GRCm39) M1185I probably benign Het
Tent5b T C 4: 133,213,924 (GRCm39) V265A possibly damaging Het
Uaca T C 9: 60,777,173 (GRCm39) V518A probably damaging Het
Ubr3 C T 2: 69,808,118 (GRCm39) Q1200* probably null Het
Ufm1 A G 3: 53,766,702 (GRCm39) probably benign Het
Zer1 G A 2: 29,998,286 (GRCm39) L342F probably damaging Het
Zfp142 G A 1: 74,609,778 (GRCm39) T1236I probably benign Het
Zfp236 A G 18: 82,651,234 (GRCm39) Y845H probably damaging Het
Zfp747l1 A T 7: 126,984,641 (GRCm39) C154S possibly damaging Het
Zfp787 T C 7: 6,135,763 (GRCm39) K163E possibly damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74,880,558 (GRCm39) splice site probably benign
IGL00542:Birc6 APN 17 74,930,766 (GRCm39) splice site probably null
IGL00659:Birc6 APN 17 74,967,648 (GRCm39) missense probably damaging 1.00
IGL00710:Birc6 APN 17 74,916,084 (GRCm39) missense probably benign 0.37
IGL00806:Birc6 APN 17 74,918,524 (GRCm39) missense possibly damaging 0.85
IGL00848:Birc6 APN 17 75,003,388 (GRCm39) nonsense probably null
IGL01071:Birc6 APN 17 74,873,127 (GRCm39) missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74,938,696 (GRCm39) missense probably damaging 1.00
IGL01121:Birc6 APN 17 74,938,033 (GRCm39) missense probably benign 0.08
IGL01132:Birc6 APN 17 74,910,055 (GRCm39) missense probably damaging 1.00
IGL01323:Birc6 APN 17 74,929,920 (GRCm39) missense probably damaging 1.00
IGL01444:Birc6 APN 17 74,938,682 (GRCm39) missense probably damaging 1.00
IGL01511:Birc6 APN 17 74,933,998 (GRCm39) nonsense probably null
IGL01576:Birc6 APN 17 74,984,365 (GRCm39) missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74,955,192 (GRCm39) missense probably benign 0.08
IGL01649:Birc6 APN 17 74,911,541 (GRCm39) missense probably benign 0.03
IGL01657:Birc6 APN 17 74,967,606 (GRCm39) missense probably damaging 1.00
IGL01739:Birc6 APN 17 74,966,216 (GRCm39) missense probably benign
IGL01756:Birc6 APN 17 74,947,203 (GRCm39) missense probably benign 0.00
IGL01807:Birc6 APN 17 74,938,032 (GRCm39) missense probably benign
IGL01885:Birc6 APN 17 74,911,511 (GRCm39) missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74,945,353 (GRCm39) missense probably damaging 1.00
IGL01915:Birc6 APN 17 74,938,715 (GRCm39) missense probably benign 0.34
IGL01998:Birc6 APN 17 74,886,880 (GRCm39) missense probably benign 0.06
IGL02084:Birc6 APN 17 74,915,277 (GRCm39) missense probably benign 0.45
IGL02086:Birc6 APN 17 74,946,822 (GRCm39) missense probably damaging 1.00
IGL02161:Birc6 APN 17 74,855,832 (GRCm39) missense probably damaging 0.99
IGL02195:Birc6 APN 17 75,004,376 (GRCm39) splice site probably benign
IGL02283:Birc6 APN 17 74,906,935 (GRCm39) missense probably benign
IGL02476:Birc6 APN 17 75,003,386 (GRCm39) missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74,959,054 (GRCm39) unclassified probably benign
IGL02547:Birc6 APN 17 74,886,640 (GRCm39) missense probably benign 0.21
IGL02678:Birc6 APN 17 74,956,898 (GRCm39) missense probably damaging 1.00
IGL02713:Birc6 APN 17 74,886,319 (GRCm39) missense probably benign
IGL02851:Birc6 APN 17 74,916,184 (GRCm39) missense probably damaging 1.00
IGL02875:Birc6 APN 17 74,896,713 (GRCm39) missense probably damaging 1.00
IGL02985:Birc6 APN 17 74,947,185 (GRCm39) missense probably benign 0.00
IGL03004:Birc6 APN 17 74,919,180 (GRCm39) missense probably benign 0.10
IGL03053:Birc6 APN 17 74,872,967 (GRCm39) missense probably damaging 1.00
IGL03085:Birc6 APN 17 74,903,945 (GRCm39) missense probably damaging 0.97
IGL03109:Birc6 APN 17 74,886,329 (GRCm39) missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74,905,994 (GRCm39) missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74,966,226 (GRCm39) missense probably benign
IGL03221:Birc6 APN 17 74,934,002 (GRCm39) missense probably benign 0.00
IGL03230:Birc6 APN 17 74,918,065 (GRCm39) missense probably damaging 1.00
IGL03294:Birc6 APN 17 74,956,881 (GRCm39) missense probably benign 0.02
IGL03399:Birc6 APN 17 74,901,368 (GRCm39) missense probably benign 0.01
Badlands UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
Big_sky UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
bitterroot UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
Black_hills UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
bottomlands UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
Chai UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
Dakota UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
Sempervirens UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
E0370:Birc6 UTSW 17 74,984,352 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
PIT4494001:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R0081:Birc6 UTSW 17 74,950,436 (GRCm39) missense probably benign 0.01
R0086:Birc6 UTSW 17 74,900,161 (GRCm39) missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74,945,371 (GRCm39) missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74,930,741 (GRCm39) splice site probably benign
R0129:Birc6 UTSW 17 74,835,755 (GRCm39) missense probably benign 0.05
R0196:Birc6 UTSW 17 74,887,282 (GRCm39) missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74,916,322 (GRCm39) missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74,969,827 (GRCm39) splice site probably benign
R0295:Birc6 UTSW 17 74,920,357 (GRCm39) intron probably benign
R0386:Birc6 UTSW 17 74,906,335 (GRCm39) missense probably damaging 0.99
R0423:Birc6 UTSW 17 75,003,292 (GRCm39) missense probably damaging 1.00
R0449:Birc6 UTSW 17 74,999,290 (GRCm39) missense probably damaging 1.00
R0453:Birc6 UTSW 17 74,956,749 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,969,620 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,959,023 (GRCm39) missense probably benign
R0564:Birc6 UTSW 17 74,932,238 (GRCm39) splice site probably benign
R0575:Birc6 UTSW 17 74,996,232 (GRCm39) missense probably damaging 1.00
R0582:Birc6 UTSW 17 74,950,332 (GRCm39) missense probably damaging 1.00
R0624:Birc6 UTSW 17 74,887,344 (GRCm39) missense probably benign 0.20
R0973:Birc6 UTSW 17 74,872,856 (GRCm39) missense probably damaging 0.99
R1061:Birc6 UTSW 17 74,996,307 (GRCm39) missense probably damaging 1.00
R1378:Birc6 UTSW 17 74,967,450 (GRCm39) missense probably damaging 1.00
R1402:Birc6 UTSW 17 75,004,528 (GRCm39) splice site probably benign
R1436:Birc6 UTSW 17 74,959,700 (GRCm39) missense probably damaging 1.00
R1456:Birc6 UTSW 17 74,916,285 (GRCm39) missense probably benign 0.35
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1474:Birc6 UTSW 17 74,886,673 (GRCm39) missense probably damaging 0.98
R1479:Birc6 UTSW 17 74,941,848 (GRCm39) missense probably damaging 1.00
R1486:Birc6 UTSW 17 74,946,815 (GRCm39) missense probably damaging 1.00
R1499:Birc6 UTSW 17 74,919,314 (GRCm39) missense probably damaging 1.00
R1515:Birc6 UTSW 17 74,835,631 (GRCm39) nonsense probably null
R1549:Birc6 UTSW 17 74,969,737 (GRCm39) missense probably damaging 1.00
R1559:Birc6 UTSW 17 74,999,232 (GRCm39) missense probably damaging 1.00
R1573:Birc6 UTSW 17 74,967,685 (GRCm39) splice site probably benign
R1615:Birc6 UTSW 17 74,916,404 (GRCm39) splice site probably null
R1621:Birc6 UTSW 17 74,977,245 (GRCm39) missense probably benign
R1680:Birc6 UTSW 17 74,855,741 (GRCm39) missense probably benign 0.01
R1743:Birc6 UTSW 17 74,886,751 (GRCm39) missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74,947,008 (GRCm39) missense probably damaging 1.00
R1775:Birc6 UTSW 17 74,919,281 (GRCm39) missense probably damaging 1.00
R1818:Birc6 UTSW 17 74,956,844 (GRCm39) missense probably damaging 1.00
R1836:Birc6 UTSW 17 74,921,385 (GRCm39) missense probably benign 0.41
R1931:Birc6 UTSW 17 74,872,977 (GRCm39) missense probably damaging 0.99
R1939:Birc6 UTSW 17 74,977,332 (GRCm39) missense probably damaging 1.00
R1964:Birc6 UTSW 17 74,941,880 (GRCm39) missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74,905,057 (GRCm39) missense probably benign 0.01
R2000:Birc6 UTSW 17 74,911,614 (GRCm39) missense possibly damaging 0.46
R2090:Birc6 UTSW 17 74,969,791 (GRCm39) missense probably benign
R2130:Birc6 UTSW 17 74,966,149 (GRCm39) splice site probably benign
R2144:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74,942,790 (GRCm39) missense probably benign 0.02
R2180:Birc6 UTSW 17 74,919,146 (GRCm39) missense probably benign 0.03
R2271:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2272:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2416:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2421:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2422:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2513:Birc6 UTSW 17 74,954,724 (GRCm39) missense probably damaging 0.97
R2912:Birc6 UTSW 17 74,999,201 (GRCm39) missense probably damaging 1.00
R3024:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3772:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3829:Birc6 UTSW 17 74,962,173 (GRCm39) missense probably damaging 1.00
R3913:Birc6 UTSW 17 74,880,608 (GRCm39) nonsense probably null
R3915:Birc6 UTSW 17 74,886,603 (GRCm39) missense probably benign 0.12
R3921:Birc6 UTSW 17 74,934,014 (GRCm39) missense probably damaging 0.98
R3928:Birc6 UTSW 17 74,945,404 (GRCm39) missense probably damaging 1.00
R3928:Birc6 UTSW 17 74,918,170 (GRCm39) missense possibly damaging 0.91
R4111:Birc6 UTSW 17 74,873,010 (GRCm39) missense probably damaging 1.00
R4155:Birc6 UTSW 17 74,903,934 (GRCm39) missense probably benign 0.00
R4163:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R4226:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4227:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4358:Birc6 UTSW 17 74,926,663 (GRCm39) splice site probably null
R4524:Birc6 UTSW 17 74,948,772 (GRCm39) missense probably damaging 1.00
R4605:Birc6 UTSW 17 74,946,929 (GRCm39) missense probably damaging 1.00
R4619:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4620:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4762:Birc6 UTSW 17 74,936,484 (GRCm39) missense probably damaging 1.00
R4814:Birc6 UTSW 17 74,956,667 (GRCm39) missense probably damaging 1.00
R4849:Birc6 UTSW 17 74,954,383 (GRCm39) missense probably damaging 0.99
R4869:Birc6 UTSW 17 74,893,007 (GRCm39) missense probably benign 0.05
R4912:Birc6 UTSW 17 74,872,900 (GRCm39) missense probably damaging 1.00
R4921:Birc6 UTSW 17 74,957,094 (GRCm39) missense probably damaging 1.00
R4942:Birc6 UTSW 17 74,930,045 (GRCm39) missense probably damaging 1.00
R4954:Birc6 UTSW 17 74,919,026 (GRCm39) missense probably damaging 1.00
R4992:Birc6 UTSW 17 74,996,251 (GRCm39) missense probably benign 0.44
R4994:Birc6 UTSW 17 74,901,319 (GRCm39) intron probably benign
R5018:Birc6 UTSW 17 74,947,054 (GRCm39) missense probably damaging 1.00
R5022:Birc6 UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
R5054:Birc6 UTSW 17 74,962,320 (GRCm39) missense probably damaging 1.00
R5068:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5069:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5070:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5196:Birc6 UTSW 17 74,913,136 (GRCm39) splice site probably benign
R5209:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5212:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5216:Birc6 UTSW 17 74,920,465 (GRCm39) missense probably damaging 1.00
R5279:Birc6 UTSW 17 74,957,042 (GRCm39) missense probably damaging 0.98
R5286:Birc6 UTSW 17 74,977,242 (GRCm39) missense probably damaging 1.00
R5399:Birc6 UTSW 17 74,911,573 (GRCm39) missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74,969,685 (GRCm39) missense probably damaging 1.00
R5482:Birc6 UTSW 17 74,948,777 (GRCm39) missense possibly damaging 0.86
R5492:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5504:Birc6 UTSW 17 74,962,208 (GRCm39) missense probably damaging 1.00
R5519:Birc6 UTSW 17 74,887,173 (GRCm39) missense probably benign
R5544:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5608:Birc6 UTSW 17 74,920,539 (GRCm39) missense probably damaging 0.99
R5623:Birc6 UTSW 17 74,835,651 (GRCm39) missense probably damaging 0.99
R5701:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R5707:Birc6 UTSW 17 75,003,399 (GRCm39) missense probably damaging 1.00
R5715:Birc6 UTSW 17 74,938,615 (GRCm39) missense probably damaging 1.00
R5734:Birc6 UTSW 17 74,925,419 (GRCm39) splice site probably benign
R5792:Birc6 UTSW 17 74,938,048 (GRCm39) missense probably benign 0.05
R5809:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5810:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5813:Birc6 UTSW 17 74,953,497 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,232 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,233 (GRCm39) missense probably damaging 0.98
R5960:Birc6 UTSW 17 74,835,760 (GRCm39) missense probably damaging 0.97
R5961:Birc6 UTSW 17 74,953,596 (GRCm39) missense probably damaging 1.00
R5967:Birc6 UTSW 17 74,967,434 (GRCm39) missense probably damaging 0.99
R5970:Birc6 UTSW 17 74,925,497 (GRCm39) missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
R5982:Birc6 UTSW 17 74,955,153 (GRCm39) missense probably benign
R6023:Birc6 UTSW 17 74,961,372 (GRCm39) missense probably benign 0.24
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6243:Birc6 UTSW 17 74,916,382 (GRCm39) missense probably damaging 0.96
R6294:Birc6 UTSW 17 74,996,252 (GRCm39) missense probably benign 0.00
R6327:Birc6 UTSW 17 74,969,774 (GRCm39) missense probably damaging 1.00
R6501:Birc6 UTSW 17 74,886,276 (GRCm39) missense probably damaging 1.00
R6810:Birc6 UTSW 17 74,919,215 (GRCm39) missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
R6822:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
R6835:Birc6 UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
R6945:Birc6 UTSW 17 74,886,526 (GRCm39) missense probably benign 0.04
R6957:Birc6 UTSW 17 74,886,486 (GRCm39) missense probably benign
R6989:Birc6 UTSW 17 74,937,984 (GRCm39) missense probably benign 0.18
R6991:Birc6 UTSW 17 74,869,090 (GRCm39) missense probably damaging 1.00
R7019:Birc6 UTSW 17 74,916,340 (GRCm39) missense probably benign 0.01
R7092:Birc6 UTSW 17 74,953,740 (GRCm39) missense probably damaging 1.00
R7158:Birc6 UTSW 17 74,901,371 (GRCm39) missense probably benign 0.25
R7204:Birc6 UTSW 17 74,947,103 (GRCm39) missense probably damaging 1.00
R7267:Birc6 UTSW 17 74,892,980 (GRCm39) missense probably benign 0.00
R7316:Birc6 UTSW 17 74,911,489 (GRCm39) missense probably damaging 0.99
R7341:Birc6 UTSW 17 74,919,069 (GRCm39) missense probably damaging 1.00
R7404:Birc6 UTSW 17 74,946,789 (GRCm39) missense possibly damaging 0.73
R7449:Birc6 UTSW 17 75,009,336 (GRCm39) missense probably benign
R7498:Birc6 UTSW 17 74,967,465 (GRCm39) missense probably damaging 1.00
R7539:Birc6 UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
R7569:Birc6 UTSW 17 74,905,077 (GRCm39) missense possibly damaging 0.71
R7574:Birc6 UTSW 17 74,886,879 (GRCm39) missense probably benign
R7611:Birc6 UTSW 17 74,969,713 (GRCm39) missense probably damaging 0.98
R7653:Birc6 UTSW 17 74,954,729 (GRCm39) missense possibly damaging 0.91
R7716:Birc6 UTSW 17 74,869,056 (GRCm39) missense probably damaging 0.99
R7728:Birc6 UTSW 17 74,929,100 (GRCm39) missense probably benign 0.01
R7810:Birc6 UTSW 17 74,855,815 (GRCm39) missense probably damaging 0.98
R7828:Birc6 UTSW 17 74,886,501 (GRCm39) missense probably damaging 0.97
R7881:Birc6 UTSW 17 74,948,666 (GRCm39) missense probably damaging 0.99
R7896:Birc6 UTSW 17 74,929,077 (GRCm39) missense probably damaging 0.99
R7950:Birc6 UTSW 17 74,900,095 (GRCm39) missense probably damaging 1.00
R7988:Birc6 UTSW 17 74,906,368 (GRCm39) splice site probably null
R8073:Birc6 UTSW 17 74,910,080 (GRCm39) missense probably damaging 1.00
R8128:Birc6 UTSW 17 74,916,253 (GRCm39) missense probably damaging 1.00
R8167:Birc6 UTSW 17 74,950,389 (GRCm39) missense probably damaging 1.00
R8236:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8237:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8255:Birc6 UTSW 17 74,969,775 (GRCm39) missense probably damaging 0.99
R8259:Birc6 UTSW 17 74,905,073 (GRCm39) missense probably benign 0.01
R8297:Birc6 UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
R8376:Birc6 UTSW 17 74,896,635 (GRCm39) missense probably benign 0.18
R8413:Birc6 UTSW 17 74,853,388 (GRCm39) missense possibly damaging 0.54
R8503:Birc6 UTSW 17 74,999,239 (GRCm39) missense probably damaging 1.00
R8504:Birc6 UTSW 17 74,959,000 (GRCm39) missense probably damaging 0.98
R8543:Birc6 UTSW 17 74,872,860 (GRCm39) missense probably damaging 1.00
R8550:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8551:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8556:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8683:Birc6 UTSW 17 74,916,114 (GRCm39) missense possibly damaging 0.74
R8751:Birc6 UTSW 17 74,955,135 (GRCm39) missense probably damaging 0.98
R8803:Birc6 UTSW 17 74,959,033 (GRCm39) missense probably damaging 0.99
R8806:Birc6 UTSW 17 74,949,311 (GRCm39) missense probably damaging 1.00
R8825:Birc6 UTSW 17 74,920,500 (GRCm39) missense probably damaging 0.99
R8888:Birc6 UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
R8972:Birc6 UTSW 17 75,009,313 (GRCm39) missense probably benign 0.05
R9069:Birc6 UTSW 17 74,868,260 (GRCm39) splice site probably benign
R9111:Birc6 UTSW 17 74,966,340 (GRCm39) missense probably damaging 0.99
R9130:Birc6 UTSW 17 74,919,146 (GRCm39) missense
R9352:Birc6 UTSW 17 74,965,347 (GRCm39) critical splice donor site probably null
R9354:Birc6 UTSW 17 74,921,401 (GRCm39) missense probably benign
R9432:Birc6 UTSW 17 74,966,216 (GRCm39) missense probably benign
R9446:Birc6 UTSW 17 74,925,491 (GRCm39) missense probably damaging 1.00
R9485:Birc6 UTSW 17 74,945,398 (GRCm39) missense probably damaging 1.00
R9499:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9551:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9552:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9585:Birc6 UTSW 17 74,916,265 (GRCm39) missense probably damaging 1.00
R9647:Birc6 UTSW 17 74,999,305 (GRCm39) missense probably damaging 1.00
R9648:Birc6 UTSW 17 74,938,696 (GRCm39) missense probably damaging 1.00
R9667:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R9696:Birc6 UTSW 17 74,947,292 (GRCm39) missense probably damaging 0.99
RF016:Birc6 UTSW 17 74,996,319 (GRCm39) missense probably damaging 1.00
Z1088:Birc6 UTSW 17 74,918,537 (GRCm39) missense probably damaging 0.99
Z1177:Birc6 UTSW 17 74,954,275 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGTGAATCTTGCTGCACAGAAC -3'
(R):5'- CAGTAGAATGTACTTACTTGACAGC -3'

Sequencing Primer
(F):5'- CTCCAGCAAATCTAGAATGGTAAATG -3'
(R):5'- AGAATGTACTTACTTGACAGCAAATG -3'
Posted On 2014-08-25