Incidental Mutation 'R2042:Eml4'
ID225148
Institutional Source Beutler Lab
Gene Symbol Eml4
Ensembl Gene ENSMUSG00000032624
Gene Nameechinoderm microtubule associated protein like 4
Synonyms4930443C24Rik
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83350931-83480361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83448178 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 323 (C323R)
Ref Sequence ENSEMBL: ENSMUSP00000107982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049503] [ENSMUST00000096766] [ENSMUST00000112363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049503
AA Change: C280R

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041880
Gene: ENSMUSG00000032624
AA Change: C280R

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 197 246 1.79e-1 SMART
Blast:WD40 252 294 3e-19 BLAST
WD40 297 336 5.97e-1 SMART
WD40 345 382 2.96e1 SMART
low complexity region 388 396 N/A INTRINSIC
WD40 397 436 1.48e-2 SMART
WD40 480 519 4.95e-4 SMART
WD40 522 560 7.92e1 SMART
WD40 563 602 5.75e-1 SMART
WD40 609 648 2.69e-5 SMART
WD40 722 762 8.04e-4 SMART
low complexity region 793 805 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096766
AA Change: C392R

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094528
Gene: ENSMUSG00000032624
AA Change: C392R

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
low complexity region 137 155 N/A INTRINSIC
Pfam:HELP 236 308 1.1e-33 PFAM
WD40 309 358 1.79e-1 SMART
Blast:WD40 364 406 4e-20 BLAST
WD40 409 448 5.97e-1 SMART
WD40 457 494 2.96e1 SMART
low complexity region 500 508 N/A INTRINSIC
WD40 509 548 1.48e-2 SMART
WD40 592 631 4.95e-4 SMART
WD40 634 672 7.92e1 SMART
WD40 675 714 5.75e-1 SMART
WD40 721 760 2.69e-5 SMART
WD40 834 874 8.04e-4 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112363
AA Change: C323R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107982
Gene: ENSMUSG00000032624
AA Change: C323R

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 240 289 1.79e-1 SMART
Blast:WD40 295 337 3e-19 BLAST
WD40 340 379 5.97e-1 SMART
WD40 388 425 2.96e1 SMART
low complexity region 431 439 N/A INTRINSIC
WD40 440 479 1.48e-2 SMART
WD40 523 562 4.95e-4 SMART
WD40 565 603 7.92e1 SMART
WD40 606 645 5.75e-1 SMART
WD40 652 691 2.69e-5 SMART
WD40 765 805 8.04e-4 SMART
low complexity region 836 848 N/A INTRINSIC
Meta Mutation Damage Score 0.9002 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the echinoderm microtubule associated protein-like family. The encoded WD-repeat protein may be involved in microtubule formation. Abnormal fusion of parts of this gene with portions of the anaplastic lymphoma receptor tyrosine kinase gene, which generates EML4-ALK fusion transcripts, is one of the primary mutations associated with non-small cell lung cancer. Alternative splicing of this gene results in two transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Mak A C 13: 41,049,436 S179A possibly damaging Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Eml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Eml4 APN 17 83448184 missense probably benign 0.05
IGL00815:Eml4 APN 17 83450790 splice site probably benign
IGL01969:Eml4 APN 17 83445980 missense possibly damaging 0.95
IGL02005:Eml4 APN 17 83477703 splice site probably benign
IGL02273:Eml4 APN 17 83456379 splice site probably null
IGL02318:Eml4 APN 17 83441366 missense probably benign 0.01
IGL02421:Eml4 APN 17 83477892 missense probably benign 0.00
IGL02728:Eml4 APN 17 83473139 splice site probably null
IGL02814:Eml4 APN 17 83441362 nonsense probably null
IGL02900:Eml4 APN 17 83477992 missense probably benign 0.00
IGL03205:Eml4 APN 17 83454444 missense probably damaging 1.00
erring UTSW 17 83448217 missense probably damaging 1.00
R0147:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0148:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0440:Eml4 UTSW 17 83446058 critical splice donor site probably null
R0541:Eml4 UTSW 17 83440042 missense probably benign 0.00
R0645:Eml4 UTSW 17 83463493 splice site probably benign
R0733:Eml4 UTSW 17 83454464 missense possibly damaging 0.88
R0944:Eml4 UTSW 17 83478060 missense probably benign 0.08
R1071:Eml4 UTSW 17 83478039 nonsense probably null
R1975:Eml4 UTSW 17 83410193 missense probably benign 0.00
R2229:Eml4 UTSW 17 83451056 missense probably benign 0.05
R2257:Eml4 UTSW 17 83477760 missense probably damaging 0.99
R2878:Eml4 UTSW 17 83410174 missense probably benign 0.01
R3820:Eml4 UTSW 17 83473065 missense probably damaging 1.00
R4466:Eml4 UTSW 17 83421674 nonsense probably null
R4620:Eml4 UTSW 17 83461533 missense probably benign 0.13
R4657:Eml4 UTSW 17 83450948 nonsense probably null
R4717:Eml4 UTSW 17 83448225 missense probably benign 0.38
R4740:Eml4 UTSW 17 83410030 missense probably damaging 1.00
R5073:Eml4 UTSW 17 83463577 missense probably damaging 1.00
R5699:Eml4 UTSW 17 83410085 missense probably benign 0.16
R5834:Eml4 UTSW 17 83477741 missense probably damaging 1.00
R5944:Eml4 UTSW 17 83446043 missense possibly damaging 0.52
R6044:Eml4 UTSW 17 83445950 missense probably damaging 1.00
R6378:Eml4 UTSW 17 83448217 missense probably damaging 1.00
R6980:Eml4 UTSW 17 83451017 missense probably benign 0.00
R7025:Eml4 UTSW 17 83425311 missense probably benign 0.04
R7037:Eml4 UTSW 17 83425327 missense probably benign 0.04
R7042:Eml4 UTSW 17 83461570 missense probably damaging 0.99
R7192:Eml4 UTSW 17 83454461 missense probably benign 0.01
R7525:Eml4 UTSW 17 83445950 missense probably damaging 1.00
R7548:Eml4 UTSW 17 83425337 missense probably benign 0.18
R7595:Eml4 UTSW 17 83456084 missense probably benign 0.18
R7791:Eml4 UTSW 17 83473706 missense probably benign 0.45
R7866:Eml4 UTSW 17 83450697 missense probably benign 0.00
R7936:Eml4 UTSW 17 83473686 missense possibly damaging 0.65
R8435:Eml4 UTSW 17 83421641 missense possibly damaging 0.78
R8447:Eml4 UTSW 17 83448227 missense probably damaging 0.99
Z1176:Eml4 UTSW 17 83445965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGGAGAATTGCCTTAC -3'
(R):5'- GTTCCACGCCAGCTTTGAAG -3'

Sequencing Primer
(F):5'- GCTTGGAGAATTGCCTTACATATTTC -3'
(R):5'- ACGCCAGCTTTGAAGGTTTATC -3'
Posted On2014-08-25