Incidental Mutation 'R0144:Mcm3ap'
ID22515
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Nameminichromosome maintenance complex component 3 associated protein
SynonymsGANP
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0144 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76468927-76515857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76481015 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 618 (T618A)
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170795]
Predicted Effect probably benign
Transcript: ENSMUST00000170795
AA Change: T618A

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: T618A

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220410
Meta Mutation Damage Score 0.0981 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76471177 missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76492935 missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76470325 missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76499566 missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76470805 missense probably benign
IGL01882:Mcm3ap APN 10 76483184 missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76471117 missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76470065 missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76484738 missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76496552 nonsense probably null
IGL02487:Mcm3ap APN 10 76507555 unclassified probably benign
IGL02488:Mcm3ap APN 10 76499649 missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76506421 missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76511033 missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76501248 missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76477767 missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76471258 splice site probably benign
IGL02955:Mcm3ap APN 10 76507466 missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76471060 missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76504697 missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76470316 missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76482733 missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76484649 splice site probably benign
Doom UTSW 10 76501314 missense probably benign
R1597_Mcm3ap_882 UTSW 10 76483226 missense probably damaging 1.00
woeful UTSW 10 76481015 missense probably benign 0.44
PIT4377001:Mcm3ap UTSW 10 76502762 missense possibly damaging 0.78
PIT4791001:Mcm3ap UTSW 10 76506473 missense probably damaging 1.00
R0105:Mcm3ap UTSW 10 76499534 missense probably damaging 1.00
R0423:Mcm3ap UTSW 10 76502705 missense probably benign 0.00
R0692:Mcm3ap UTSW 10 76483169 missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76477914 unclassified probably benign
R1441:Mcm3ap UTSW 10 76471166 missense probably benign
R1512:Mcm3ap UTSW 10 76470513 missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76504287 missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76483188 missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76496541 missense probably benign 0.36
R1597:Mcm3ap UTSW 10 76483226 missense probably damaging 1.00
R1743:Mcm3ap UTSW 10 76484674 missense possibly damaging 0.53
R1773:Mcm3ap UTSW 10 76471160 missense probably benign
R1922:Mcm3ap UTSW 10 76507361 missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76470068 missense probably benign 0.43
R2097:Mcm3ap UTSW 10 76512489 missense probably damaging 1.00
R2436:Mcm3ap UTSW 10 76490057 missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76489426 missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76482679 missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76506446 missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76507337 missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76470570 missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76488466 missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76484661 nonsense probably null
R4907:Mcm3ap UTSW 10 76493441 missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76502702 missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76507539 missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76470926 missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76483314 missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76496482 nonsense probably null
R5473:Mcm3ap UTSW 10 76502759 missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76481096 missense possibly damaging 0.89
R5931:Mcm3ap UTSW 10 76471166 missense probably benign
R5939:Mcm3ap UTSW 10 76508361 missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76488419 missense possibly damaging 0.46
R5998:Mcm3ap UTSW 10 76481142 critical splice donor site probably null
R6122:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R6192:Mcm3ap UTSW 10 76501100 missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76515706 missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76471478 nonsense probably null
R6669:Mcm3ap UTSW 10 76507337 missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76489532 missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76501314 missense probably benign
R6864:Mcm3ap UTSW 10 76507479 missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76470215 missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76504253 missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76515666 missense probably benign 0.09
R7212:Mcm3ap UTSW 10 76501311 missense probably benign 0.01
R7403:Mcm3ap UTSW 10 76482823 critical splice donor site probably null
R7470:Mcm3ap UTSW 10 76508397 missense probably damaging 1.00
R7561:Mcm3ap UTSW 10 76492878 missense possibly damaging 0.94
R7610:Mcm3ap UTSW 10 76496720 splice site probably null
R7620:Mcm3ap UTSW 10 76470433 missense probably benign 0.00
R7898:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R8266:Mcm3ap UTSW 10 76476580 nonsense probably null
R8355:Mcm3ap UTSW 10 76493501 missense probably benign 0.32
R8367:Mcm3ap UTSW 10 76477859 missense possibly damaging 0.65
R8867:Mcm3ap UTSW 10 76470704 missense probably benign 0.31
X0026:Mcm3ap UTSW 10 76482785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGGGATCACAGGCTGATTTT -3'
(R):5'- TCCCTGGGACAACTTCAAACAC -3'

Sequencing Primer
(F):5'- GTAAGTACACTGTAGCTGTC -3'
(R):5'- CTCAAGTACCGCTCCTTCTC -3'
Posted On2013-04-16