Incidental Mutation 'R1991:Col18a1'
ID 225172
Institutional Source Beutler Lab
Gene Symbol Col18a1
Ensembl Gene ENSMUSG00000001435
Gene Name collagen, type XVIII, alpha 1
Synonyms endostatin
MMRRC Submission 040002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1991 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 77052178-77166548 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77081154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000122580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072755] [ENSMUST00000081654] [ENSMUST00000105409] [ENSMUST00000156009]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000072755
AA Change: I783V
SMART Domains Protein: ENSMUSP00000072538
Gene: ENSMUSG00000001435
AA Change: I783V

DomainStartEndE-ValueType
Pfam:DUF959 16 218 6.8e-104 PFAM
low complexity region 295 307 N/A INTRINSIC
FRI 369 484 4.03e-47 SMART
TSPN 492 680 4.25e-72 SMART
LamG 541 679 2.17e-2 SMART
low complexity region 699 715 N/A INTRINSIC
low complexity region 719 734 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
Pfam:Collagen 820 881 5.5e-11 PFAM
low complexity region 921 942 N/A INTRINSIC
Pfam:Collagen 951 1008 6.1e-10 PFAM
Pfam:Collagen 988 1053 1.4e-8 PFAM
Pfam:Collagen 1060 1117 7.3e-10 PFAM
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1166 1181 N/A INTRINSIC
low complexity region 1186 1202 N/A INTRINSIC
Pfam:Collagen 1207 1267 8.2e-10 PFAM
low complexity region 1275 1288 N/A INTRINSIC
low complexity region 1301 1319 N/A INTRINSIC
low complexity region 1358 1393 N/A INTRINSIC
low complexity region 1397 1414 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1441 1454 N/A INTRINSIC
Pfam:Endostatin 1461 1769 4.4e-116 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000081654
AA Change: I324V
SMART Domains Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435
AA Change: I324V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
TSPN 33 221 4.25e-72 SMART
LamG 82 220 2.17e-2 SMART
low complexity region 240 256 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Pfam:Collagen 359 422 1.6e-10 PFAM
low complexity region 462 483 N/A INTRINSIC
Pfam:Collagen 492 549 1.6e-9 PFAM
Pfam:Collagen 529 594 3.3e-8 PFAM
Pfam:Collagen 601 658 1.9e-9 PFAM
Pfam:Collagen 631 689 4e-8 PFAM
Pfam:Collagen 701 752 1.7e-7 PFAM
Pfam:Collagen 748 808 2.2e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 842 860 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 938 955 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Pfam:Endostatin 999 1315 8.2e-151 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105409
AA Change: I536V
SMART Domains Protein: ENSMUSP00000101049
Gene: ENSMUSG00000001435
AA Change: I536V

DomainStartEndE-ValueType
Pfam:DUF959 16 219 3.6e-100 PFAM
TSPN 245 433 4.25e-72 SMART
LamG 294 432 2.17e-2 SMART
low complexity region 452 468 N/A INTRINSIC
low complexity region 472 487 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 542 613 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
low complexity region 674 695 N/A INTRINSIC
Pfam:Collagen 700 761 5.4e-9 PFAM
Pfam:Collagen 741 806 4e-8 PFAM
Pfam:Collagen 813 874 2.1e-10 PFAM
Pfam:Collagen 846 901 1.2e-7 PFAM
Pfam:Collagen 913 964 2.1e-7 PFAM
Pfam:Collagen 960 1020 2.6e-9 PFAM
low complexity region 1028 1041 N/A INTRINSIC
low complexity region 1054 1072 N/A INTRINSIC
low complexity region 1111 1146 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1170 1186 N/A INTRINSIC
low complexity region 1194 1207 N/A INTRINSIC
Pfam:Endostatin 1211 1527 1.1e-150 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156009
AA Change: I114V
SMART Domains Protein: ENSMUSP00000122580
Gene: ENSMUSG00000001435
AA Change: I114V

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 50 65 N/A INTRINSIC
low complexity region 70 82 N/A INTRINSIC
low complexity region 120 161 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (124/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVIII collagen. This collagen is one of the multiplexins, extracellular matrix proteins that contain multiple triple-helix domains (collagenous domains) interrupted by non-collagenous domains. A long isoform of the protein has an N-terminal domain that is homologous to the extracellular part of frizzled receptors. Proteolytic processing at several endogenous cleavage sites in the C-terminal domain results in production of endostatin, a potent antiangiogenic protein that is able to inhibit angiogenesis and tumor growth. Mutations in this gene are associated with Knobloch syndrome. The main features of this syndrome involve retinal abnormalities, so type XVIII collagen may play an important role in retinal structure and in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in hyaloid vessel regression, attenuated visual function, abnormal electroretinograms, broad proximal tubule basement membrane, podocyte effacement, and softened glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Afap1l2 A T 19: 57,002,267 I18N possibly damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Amigo1 T C 3: 108,187,328 S48P probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Arhgap22 A G 14: 33,366,959 N466D probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Ascc2 A G 11: 4,679,257 E523G probably benign Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Bag3 C T 7: 128,545,683 H341Y probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cep290 T A 10: 100,531,184 S1132R possibly damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Cped1 A G 6: 22,233,927 T847A probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Creb3 C A 4: 43,565,327 R202S probably damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Erc2 A G 14: 28,011,636 I556V probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fhad1 T C 4: 141,982,162 S294G possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gpr161 G T 1: 165,306,563 M131I probably damaging Het
Gpr22 T A 12: 31,709,203 M270L probably benign Het
Grin3b C A 10: 79,970,912 Q5K probably benign Het
Grin3b C T 10: 79,974,646 A662V probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Klhl25 T A 7: 75,866,732 V157D probably damaging Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Krt81 T C 15: 101,462,554 Q184R probably benign Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Letm1 A AG 5: 33,769,515 probably null Het
Lin54 A G 5: 100,485,801 probably null Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Manba T A 3: 135,551,191 D538E probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mfap4 T C 11: 61,485,807 probably null Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek4 A G 14: 30,956,953 I145V probably damaging Het
Nlrp14 T C 7: 107,196,200 V230A probably benign Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr421-ps1 C T 1: 174,152,121 H202Y probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr745 G A 14: 50,642,866 C195Y possibly damaging Het
Pcdhb13 C T 18: 37,443,859 T430I possibly damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Pigm T G 1: 172,377,261 L188R probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Plk5 C T 10: 80,363,102 S435L possibly damaging Het
Pms1 G A 1: 53,282,042 L11F probably damaging Het
Prl3b1 C T 13: 27,247,912 T140I possibly damaging Het
Prl7a1 T G 13: 27,633,672 D203A probably damaging Het
Psg17 A G 7: 18,814,652 V398A probably benign Het
Pum1 T A 4: 130,718,218 I166K possibly damaging Het
R3hdm1 T A 1: 128,169,016 D108E probably damaging Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rnf112 C T 11: 61,452,426 R141Q probably damaging Het
Rnf145 T C 11: 44,561,466 V424A possibly damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint5 T C 2: 164,716,983 probably benign Het
Ssr2 T A 3: 88,576,867 probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tfpi A C 2: 84,458,016 probably benign Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim30a T A 7: 104,430,230 probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tstd2 A G 4: 46,120,563 I279T probably benign Het
Ttn C T 2: 76,946,391 probably null Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ush2a C T 1: 188,578,532 probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Virma T A 4: 11,519,242 C830S probably benign Het
Vmn1r7 A T 6: 57,024,868 S136T probably benign Het
Vmn2r9 A G 5: 108,846,439 V448A probably damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Wdr63 G T 3: 146,063,480 T522K possibly damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zc3hav1 C A 6: 38,336,517 V198L probably damaging Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Zfr2 A T 10: 81,242,852 D306V possibly damaging Het
Other mutations in Col18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col18a1 APN 10 77069979 missense possibly damaging 0.93
IGL01023:Col18a1 APN 10 77070975 missense probably damaging 0.98
IGL01304:Col18a1 APN 10 77076141 unclassified probably benign
IGL01519:Col18a1 APN 10 77059323 missense probably damaging 0.99
IGL02217:Col18a1 APN 10 77053298 missense probably damaging 0.96
IGL02275:Col18a1 APN 10 77059383 missense possibly damaging 0.92
IGL02283:Col18a1 APN 10 77113109 missense possibly damaging 0.71
IGL02492:Col18a1 APN 10 77072021 splice site probably benign
IGL02673:Col18a1 APN 10 77059163 missense probably damaging 1.00
IGL02710:Col18a1 APN 10 77113312 missense possibly damaging 0.92
IGL02850:Col18a1 APN 10 77096466 missense probably damaging 0.98
IGL03085:Col18a1 APN 10 77059181 splice site probably benign
IGL03102:Col18a1 APN 10 77067623 splice site probably benign
IGL03139:Col18a1 APN 10 77113343 missense possibly damaging 0.84
IGL03181:Col18a1 APN 10 77055698 missense probably damaging 1.00
IGL03183:Col18a1 APN 10 77073754 missense probably damaging 1.00
R0039:Col18a1 UTSW 10 77077168 missense probably damaging 1.00
R0180:Col18a1 UTSW 10 77096517 missense probably benign 0.33
R0225:Col18a1 UTSW 10 77088914 missense possibly damaging 0.90
R0335:Col18a1 UTSW 10 77059363 missense probably damaging 0.99
R0336:Col18a1 UTSW 10 77058736 missense probably damaging 1.00
R1471:Col18a1 UTSW 10 77096206 missense unknown
R1538:Col18a1 UTSW 10 77071336 missense probably damaging 1.00
R1594:Col18a1 UTSW 10 77113036 missense possibly damaging 0.51
R1631:Col18a1 UTSW 10 77059297 missense probably damaging 0.99
R1774:Col18a1 UTSW 10 77059981 missense probably damaging 0.96
R1934:Col18a1 UTSW 10 77112744 missense possibly damaging 0.73
R1990:Col18a1 UTSW 10 77081154 missense unknown
R1992:Col18a1 UTSW 10 77081154 missense unknown
R2081:Col18a1 UTSW 10 77054185 missense probably damaging 1.00
R2082:Col18a1 UTSW 10 77059293 missense probably damaging 1.00
R2351:Col18a1 UTSW 10 77112704 missense probably benign 0.00
R2510:Col18a1 UTSW 10 77096268 missense unknown
R3076:Col18a1 UTSW 10 77088928 missense possibly damaging 0.57
R3433:Col18a1 UTSW 10 77096268 missense unknown
R3800:Col18a1 UTSW 10 77067387 nonsense probably null
R3918:Col18a1 UTSW 10 77053358 missense probably benign 0.05
R3981:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R3983:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R4182:Col18a1 UTSW 10 77058841 splice site probably null
R4239:Col18a1 UTSW 10 77096167 missense unknown
R5014:Col18a1 UTSW 10 77070960 critical splice donor site probably null
R5107:Col18a1 UTSW 10 77077223 critical splice acceptor site probably null
R5413:Col18a1 UTSW 10 77069476 missense probably damaging 1.00
R5503:Col18a1 UTSW 10 77071620 missense probably damaging 1.00
R5524:Col18a1 UTSW 10 77058724 missense probably damaging 1.00
R5772:Col18a1 UTSW 10 77166343 missense unknown
R5958:Col18a1 UTSW 10 77096397 missense probably benign 0.01
R6280:Col18a1 UTSW 10 77112489 intron probably benign
R6309:Col18a1 UTSW 10 77112742 intron probably benign
R6603:Col18a1 UTSW 10 77063977 critical splice donor site probably null
R6608:Col18a1 UTSW 10 77112794 intron probably benign
R6805:Col18a1 UTSW 10 77054239 missense probably damaging 1.00
R6890:Col18a1 UTSW 10 77113484 intron probably benign
R6938:Col18a1 UTSW 10 77112499 intron probably benign
R7002:Col18a1 UTSW 10 77166343 missense unknown
R7154:Col18a1 UTSW 10 77072965 missense probably benign 0.25
R7204:Col18a1 UTSW 10 77085276 missense unknown
R7278:Col18a1 UTSW 10 77096284 missense unknown
R7442:Col18a1 UTSW 10 77096238 missense unknown
R7453:Col18a1 UTSW 10 77085210 splice site probably null
R7597:Col18a1 UTSW 10 77113303 missense unknown
R7615:Col18a1 UTSW 10 77067005 missense probably damaging 1.00
R7671:Col18a1 UTSW 10 77085383 missense unknown
R7696:Col18a1 UTSW 10 77085272 missense unknown
R7719:Col18a1 UTSW 10 77078012 missense probably benign 0.13
R7772:Col18a1 UTSW 10 77068386 splice site probably null
R8077:Col18a1 UTSW 10 77080851 missense unknown
R8085:Col18a1 UTSW 10 77088907 missense unknown
R8097:Col18a1 UTSW 10 77112508 missense unknown
R8117:Col18a1 UTSW 10 77059974 missense probably benign 0.41
R8130:Col18a1 UTSW 10 77074450 missense probably benign 0.03
R8151:Col18a1 UTSW 10 77112584 missense unknown
R8379:Col18a1 UTSW 10 77053238 missense probably benign 0.08
R8479:Col18a1 UTSW 10 77081154 missense unknown
R8523:Col18a1 UTSW 10 77054234 missense probably damaging 0.99
R8862:Col18a1 UTSW 10 77113210 nonsense probably null
R9109:Col18a1 UTSW 10 77057370 missense probably damaging 1.00
R9298:Col18a1 UTSW 10 77057370 missense probably damaging 1.00
R9312:Col18a1 UTSW 10 77058772 missense probably damaging 0.98
R9366:Col18a1 UTSW 10 77096424 missense unknown
R9399:Col18a1 UTSW 10 77080750 missense unknown
R9559:Col18a1 UTSW 10 77077796 missense probably damaging 1.00
R9649:Col18a1 UTSW 10 77080839 missense unknown
R9689:Col18a1 UTSW 10 77080744 nonsense probably null
R9719:Col18a1 UTSW 10 77113598 missense unknown
Z1176:Col18a1 UTSW 10 77055709 missense possibly damaging 0.81
Z1176:Col18a1 UTSW 10 77112851 missense unknown
Z1177:Col18a1 UTSW 10 77112838 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTTCAGCAGGGTATGGAG -3'
(R):5'- GAAAGACAGGTGGCCATTCC -3'

Sequencing Primer
(F):5'- CAGGGTATGGAGGGAGGGTTC -3'
(R):5'- AGACAGGTGGCCATTCCCATAG -3'
Posted On 2014-08-25