Incidental Mutation 'R1991:Zfr2'
ID 225180
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Name zinc finger RNA binding protein 2
Synonyms 2010013I23Rik, 9130206N08Rik
MMRRC Submission 040002-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R1991 (G1)
Quality Score 208
Status Validated
Chromosome 10
Chromosomal Location 81068989-81087957 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81078686 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 306 (D306V)
Ref Sequence ENSEMBL: ENSMUSP00000113913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798]
AlphaFold E9Q5M4
Predicted Effect possibly damaging
Transcript: ENSMUST00000117798
AA Change: D306V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: D306V

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (124/124)
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,771,419 (GRCm39) R203* probably null Het
Abcc2 A T 19: 43,795,581 (GRCm39) I446F probably damaging Het
Afap1l2 A T 19: 56,990,699 (GRCm39) I18N possibly damaging Het
Aida A T 1: 183,094,627 (GRCm39) E107D probably benign Het
Amer2 A G 14: 60,617,269 (GRCm39) Y362C probably damaging Het
Amigo1 T C 3: 108,094,644 (GRCm39) S48P probably benign Het
Ano5 A G 7: 51,187,561 (GRCm39) K50R possibly damaging Het
Anxa2 A T 9: 69,391,098 (GRCm39) D95V probably damaging Het
Arhgap22 A G 14: 33,088,916 (GRCm39) N466D probably damaging Het
Armc3 T C 2: 19,297,953 (GRCm39) Y575H probably damaging Het
Ascc2 A G 11: 4,629,257 (GRCm39) E523G probably benign Het
B3galt5 A T 16: 96,117,225 (GRCm39) K286M probably damaging Het
Bag3 C T 7: 128,147,407 (GRCm39) H341Y probably benign Het
Blm G T 7: 80,155,697 (GRCm39) probably null Het
Cacna1b G A 2: 24,622,318 (GRCm39) P222L probably damaging Het
Cap2 T A 13: 46,791,357 (GRCm39) Y175N possibly damaging Het
Cd81 G T 7: 142,620,938 (GRCm39) G206* probably null Het
Cep290 T A 10: 100,367,046 (GRCm39) S1132R possibly damaging Het
Cluh C A 11: 74,550,355 (GRCm39) C222* probably null Het
Col14a1 A T 15: 55,313,336 (GRCm39) D1320V unknown Het
Col18a1 T C 10: 76,916,988 (GRCm39) I114V unknown Het
Cped1 A G 6: 22,233,926 (GRCm39) T847A probably damaging Het
Cpne7 A G 8: 123,854,176 (GRCm39) K288E possibly damaging Het
Cr2 G A 1: 194,836,458 (GRCm39) P1278S possibly damaging Het
Creb3 C A 4: 43,565,327 (GRCm39) R202S probably damaging Het
Cyp2j9 T A 4: 96,460,201 (GRCm39) K434M probably damaging Het
Dnai3 G T 3: 145,769,235 (GRCm39) T522K possibly damaging Het
Dpp10 A T 1: 123,832,833 (GRCm39) V48E probably null Het
Dsg2 A G 18: 20,734,530 (GRCm39) K836R probably damaging Het
Dst A G 1: 34,229,339 (GRCm39) T1986A probably benign Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Ecm2 A G 13: 49,683,732 (GRCm39) D570G probably benign Het
Efhc1 T A 1: 21,059,784 (GRCm39) C611* probably null Het
Epop T C 11: 97,519,480 (GRCm39) T210A probably benign Het
Erc2 A G 14: 27,733,593 (GRCm39) I556V probably benign Het
Fdxacb1 A T 9: 50,682,946 (GRCm39) N101I probably benign Het
Fhad1 T C 4: 141,709,473 (GRCm39) S294G possibly damaging Het
Galnt16 A G 12: 80,630,430 (GRCm39) D262G probably damaging Het
Gorab A G 1: 163,224,625 (GRCm39) S59P probably damaging Het
Gpr161 G T 1: 165,134,132 (GRCm39) M131I probably damaging Het
Gpr22 T A 12: 31,759,202 (GRCm39) M270L probably benign Het
Grin3b C A 10: 79,806,746 (GRCm39) Q5K probably benign Het
Grin3b C T 10: 79,810,480 (GRCm39) A662V probably damaging Het
Gsdmc A G 15: 63,673,748 (GRCm39) I179T probably benign Het
Gsdmc2 T A 15: 63,700,086 (GRCm39) M229L probably benign Het
H2-Eb2 A G 17: 34,553,278 (GRCm39) I155V probably benign Het
Hoga1 A C 19: 42,048,459 (GRCm39) probably null Het
Hs3st5 A G 10: 36,708,882 (GRCm39) Y139C probably damaging Het
Il10ra C A 9: 45,167,109 (GRCm39) A481S probably benign Het
Ints2 T A 11: 86,139,760 (GRCm39) H278L possibly damaging Het
Kalrn T G 16: 33,796,108 (GRCm39) L1222F probably damaging Het
Klhl25 T A 7: 75,516,480 (GRCm39) V157D probably damaging Het
Klk1b26 A T 7: 43,666,324 (GRCm39) T256S probably damaging Het
Krt81 T C 15: 101,360,435 (GRCm39) Q184R probably benign Het
Lce1k A T 3: 92,714,125 (GRCm39) C20S unknown Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lin54 A G 5: 100,633,660 (GRCm39) probably null Het
Lrrc37a T C 11: 103,391,087 (GRCm39) E1446G probably benign Het
Macf1 A G 4: 123,350,488 (GRCm39) S3792P probably damaging Het
Manba T A 3: 135,256,952 (GRCm39) D538E probably benign Het
Mcc C A 18: 44,624,382 (GRCm39) E213* probably null Het
Mfap4 T C 11: 61,376,633 (GRCm39) probably null Het
Muc21 A T 17: 35,929,600 (GRCm39) S1529T probably benign Het
Nebl T A 2: 17,457,321 (GRCm39) I80F probably damaging Het
Nek4 A G 14: 30,678,910 (GRCm39) I145V probably damaging Het
Nlrp14 T C 7: 106,795,407 (GRCm39) V230A probably benign Het
Nxf3 G A X: 134,976,583 (GRCm39) P380S possibly damaging Het
Or11h6 G A 14: 50,880,323 (GRCm39) C195Y possibly damaging Het
Or1a1 T C 11: 74,086,989 (GRCm39) V220A probably damaging Het
Or5b99 T C 19: 12,976,866 (GRCm39) V172A possibly damaging Het
Or5p66 C A 7: 107,885,566 (GRCm39) G256* probably null Het
Or6k8-ps1 C T 1: 173,979,687 (GRCm39) H202Y probably damaging Het
Pcdhb13 C T 18: 37,576,912 (GRCm39) T430I possibly damaging Het
Piezo2 A T 18: 63,207,733 (GRCm39) L1426Q probably null Het
Pigk T A 3: 152,450,131 (GRCm39) Y212N probably damaging Het
Pigm T G 1: 172,204,828 (GRCm39) L188R probably damaging Het
Plce1 T C 19: 38,766,368 (GRCm39) F2117S probably damaging Het
Plec A G 15: 76,057,743 (GRCm39) F4055L probably damaging Het
Plk5 C T 10: 80,198,936 (GRCm39) S435L possibly damaging Het
Pms1 G A 1: 53,321,201 (GRCm39) L11F probably damaging Het
Prl3b1 C T 13: 27,431,895 (GRCm39) T140I possibly damaging Het
Prl7a1 T G 13: 27,817,655 (GRCm39) D203A probably damaging Het
Psg17 A G 7: 18,548,577 (GRCm39) V398A probably benign Het
Pum1 T A 4: 130,445,529 (GRCm39) I166K possibly damaging Het
R3hdm1 T A 1: 128,096,753 (GRCm39) D108E probably damaging Het
Reln A T 5: 22,174,358 (GRCm39) D1948E possibly damaging Het
Rnf112 C T 11: 61,343,252 (GRCm39) R141Q probably damaging Het
Rnf145 T C 11: 44,452,293 (GRCm39) V424A possibly damaging Het
Serpina3m C A 12: 104,355,958 (GRCm39) Y208* probably null Het
Serpind1 T C 16: 17,160,808 (GRCm39) V446A probably benign Het
Shc3 T A 13: 51,596,872 (GRCm39) M384L probably benign Het
Slc38a11 A G 2: 65,160,683 (GRCm39) F304L probably benign Het
Slpi C T 2: 164,197,463 (GRCm39) C28Y probably damaging Het
Specc1 C A 11: 61,920,120 (GRCm39) P7T possibly damaging Het
Spib T C 7: 44,178,281 (GRCm39) E180G probably benign Het
Spint5 T C 2: 164,558,903 (GRCm39) probably benign Het
Ssr2 T A 3: 88,484,174 (GRCm39) probably benign Het
Tbrg1 T C 9: 37,560,715 (GRCm39) D387G probably benign Het
Tex14 T G 11: 87,440,296 (GRCm39) L1367R probably damaging Het
Tfpi A C 2: 84,288,360 (GRCm39) probably benign Het
Tlr5 T A 1: 182,801,912 (GRCm39) D405E probably damaging Het
Tnnt3 C T 7: 142,065,262 (GRCm39) R131C possibly damaging Het
Tnxb T C 17: 34,890,878 (GRCm39) V407A probably damaging Het
Tnxb A G 17: 34,901,225 (GRCm39) Y1013C probably damaging Het
Tpx2 T A 2: 152,732,544 (GRCm39) M606K probably benign Het
Trim30a T A 7: 104,079,437 (GRCm39) probably benign Het
Trim46 A T 3: 89,145,008 (GRCm39) Y489N probably damaging Het
Trpm6 A T 19: 18,773,648 (GRCm39) H380L probably benign Het
Tstd2 A G 4: 46,120,563 (GRCm39) I279T probably benign Het
Ttn C T 2: 76,776,735 (GRCm39) probably null Het
Txnl1 T C 18: 63,812,585 (GRCm39) T70A probably benign Het
Ush2a C T 1: 188,310,729 (GRCm39) probably benign Het
Usp1 A G 4: 98,822,531 (GRCm39) D615G probably benign Het
Virma T A 4: 11,519,242 (GRCm39) C830S probably benign Het
Vmn1r7 A T 6: 57,001,853 (GRCm39) S136T probably benign Het
Vmn2r9 A G 5: 108,994,305 (GRCm39) V448A probably damaging Het
Vps11 G A 9: 44,270,524 (GRCm39) H183Y probably damaging Het
Vsig10l A G 7: 43,116,892 (GRCm39) T476A possibly damaging Het
Whamm C T 7: 81,241,519 (GRCm39) R277* probably null Het
Wnt8a A G 18: 34,677,937 (GRCm39) D115G probably damaging Het
Xndc1 T A 7: 101,722,398 (GRCm39) V21E probably damaging Het
Zc3hav1 C A 6: 38,313,452 (GRCm39) V198L probably damaging Het
Zfp874a T A 13: 67,590,623 (GRCm39) I354F probably benign Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81,077,919 (GRCm39) missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81,087,193 (GRCm39) missense probably benign
IGL01623:Zfr2 APN 10 81,087,193 (GRCm39) missense probably benign
IGL02719:Zfr2 APN 10 81,080,546 (GRCm39) missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81,077,985 (GRCm39) missense probably benign 0.01
R0302:Zfr2 UTSW 10 81,087,170 (GRCm39) unclassified probably benign
R0837:Zfr2 UTSW 10 81,081,242 (GRCm39) missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81,083,225 (GRCm39) missense probably benign 0.01
R1714:Zfr2 UTSW 10 81,080,583 (GRCm39) missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81,077,919 (GRCm39) missense probably damaging 0.96
R2134:Zfr2 UTSW 10 81,078,735 (GRCm39) missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81,077,950 (GRCm39) missense probably benign 0.13
R2150:Zfr2 UTSW 10 81,077,950 (GRCm39) missense probably benign 0.13
R3703:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3704:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3705:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3715:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R4301:Zfr2 UTSW 10 81,078,018 (GRCm39) unclassified probably benign
R4654:Zfr2 UTSW 10 81,087,083 (GRCm39) splice site probably null
R4811:Zfr2 UTSW 10 81,079,547 (GRCm39) missense probably benign 0.07
R5290:Zfr2 UTSW 10 81,082,544 (GRCm39) frame shift probably null
R5781:Zfr2 UTSW 10 81,079,547 (GRCm39) missense probably benign 0.07
R7114:Zfr2 UTSW 10 81,080,559 (GRCm39) missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81,078,649 (GRCm39) missense possibly damaging 0.83
R8359:Zfr2 UTSW 10 81,078,653 (GRCm39) missense possibly damaging 0.57
R8389:Zfr2 UTSW 10 81,081,323 (GRCm39) missense probably benign
R8827:Zfr2 UTSW 10 81,078,619 (GRCm39) missense probably benign 0.00
R8953:Zfr2 UTSW 10 81,084,271 (GRCm39) missense probably damaging 0.99
R9086:Zfr2 UTSW 10 81,076,029 (GRCm39) missense probably damaging 0.96
R9189:Zfr2 UTSW 10 81,080,496 (GRCm39) missense probably damaging 1.00
R9487:Zfr2 UTSW 10 81,075,969 (GRCm39) missense probably benign 0.33
R9592:Zfr2 UTSW 10 81,069,580 (GRCm39) missense unknown
R9645:Zfr2 UTSW 10 81,084,252 (GRCm39) nonsense probably null
X0063:Zfr2 UTSW 10 81,078,791 (GRCm39) critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81,081,918 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTTTCCACAGAGTAGAGAAACC -3'
(R):5'- CCAAAGGACAGTGACCTTCC -3'

Sequencing Primer
(F):5'- CCACAGAGTAGAGAAACCAGGGC -3'
(R):5'- TCTCTGTGAGTCTGAGACCAGC -3'
Posted On 2014-08-25