Mutagenetix > Incidental Mutations

Incidental Mutation 'R0144:Brca1'

22520

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

038429-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0144 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101526121 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 396 (S396T)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

Predicted Effect

probably damaging
Transcript: ENSMUST00000017290
AA Change: S396T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: S396T

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 87.0%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd4	T	A	12: 84,605,965		probably null	Het
Acp6	T	A	3: 97,165,829		probably benign	Het
AI661453	A	T	17: 47,469,299		probably benign	Het
Aox1	A	G	1: 58,070,074	I674V	probably benign	Het
Armc2	A	T	10: 41,947,887		probably benign	Het
Atp8b1	G	C	18: 64,571,374		probably benign	Het
Baz2b	A	T	2: 59,907,495	N1823K	probably damaging	Het
Bbx	C	T	16: 50,280,392	E47K	probably benign	Het
Btnl6	G	T	17: 34,514,020	R290S	probably benign	Het
Casp8ap2	A	G	4: 32,643,797	R957G	possibly damaging	Het
Ccdc13	A	G	9: 121,827,351	L132P	probably damaging	Het
Ccdc187	A	G	2: 26,276,203	I738T	probably damaging	Het
Ccdc58	A	T	16: 36,085,114	N92I	possibly damaging	Het
Ceacam15	G	T	7: 16,673,191	H134N	probably benign	Het
Cep170	T	C	1: 176,792,595	I46V	probably benign	Het
Cfap57	T	C	4: 118,584,705	D722G	probably damaging	Het
Col11a1	A	T	3: 114,113,594	D628V	unknown	Het
Csmd1	A	T	8: 16,391,824	V342E	probably benign	Het
Dennd1a	A	G	2: 38,126,640	V64A	probably damaging	Het
Dlec1	G	T	9: 119,142,866	G1345V	probably benign	Het
Dnah1	G	A	14: 31,267,874		probably benign	Het
Dock5	C	T	14: 67,786,286	G1142D	probably benign	Het
Etv2	C	A	7: 30,634,883	A142S	probably benign	Het
Fam110c	C	A	12: 31,074,501	T154K	unknown	Het
Fbxo17	C	G	7: 28,735,340	D183E	probably damaging	Het
Fbxo30	T	A	10: 11,295,220	W681R	probably damaging	Het
Fig4	A	G	10: 41,258,049	Y413H	probably damaging	Het
Gab1	A	G	8: 80,785,201		probably benign	Het
Gabarapl1	T	C	6: 129,533,448	M1T	probably null	Het
Gm4763	A	G	7: 24,723,590	V101A	possibly damaging	Het
H2-M10.6	G	A	17: 36,812,241	C22Y	probably damaging	Het
Igfn1	T	C	1: 135,962,013	D2432G	probably damaging	Het
Il13	T	C	11: 53,633,176	D60G	possibly damaging	Het
Iqgap1	A	G	7: 80,751,920	L479P	probably damaging	Het
Itpr2	T	A	6: 146,327,155	Q1314L	probably damaging	Het
Jrk	C	T	15: 74,706,156	G427S	probably benign	Het
Kcnb1	T	G	2: 167,104,547	N794H	probably damaging	Het
Klhl8	A	T	5: 103,867,938	S361R	probably benign	Het
Krt87	T	C	15: 101,438,661	Y37C	probably benign	Het
Lbp	A	T	2: 158,319,710	S231C	probably damaging	Het
Lpin2	A	G	17: 71,225,076	E142G	probably damaging	Het
Lrch4	G	A	5: 137,638,543		probably null	Het
Manea	A	G	4: 26,340,719	M81T	probably benign	Het
Mcm3ap	A	G	10: 76,481,015	T618A	probably benign	Het
Me3	A	G	7: 89,739,872	D128G	probably damaging	Het
Mug2	A	G	6: 122,071,011		probably benign	Het
Myo9b	A	T	8: 71,346,043	Q901L	probably damaging	Het
Nalcn	C	T	14: 123,409,839		probably benign	Het
Nalcn	T	C	14: 123,371,536	R640G	probably damaging	Het
Ncor1	T	C	11: 62,392,595	N422S	probably damaging	Het
Nf1	T	A	11: 79,547,127	Y88N	probably damaging	Het
Nrxn3	G	A	12: 89,348,392	A358T	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr486	T	C	7: 108,171,971	I258V	probably benign	Het
Olfr593	A	T	7: 103,212,540	I216F	probably damaging	Het
Phlpp2	C	T	8: 109,907,513	R242W	probably damaging	Het
Pld5	T	C	1: 175,970,541	N431D	probably benign	Het
Prss28	G	A	17: 25,309,450	V16M	probably damaging	Het
Psmd2	T	A	16: 20,662,225		probably null	Het
Ptpn21	A	T	12: 98,688,609	S700T	probably benign	Het
Rasa2	A	T	9: 96,592,019	V152D	probably damaging	Het
Reln	G	T	5: 21,948,449	R2286S	probably damaging	Het
Rflnb	G	T	11: 76,024,963	P102Q	probably damaging	Het
Rin2	G	A	2: 145,876,639	V680I	probably damaging	Het
Rnf213	A	T	11: 119,479,600	K4742*	probably null	Het
Rpp40	A	T	13: 35,901,369	S143T	probably benign	Het
Rps12	A	G	10: 23,786,791	I51T	probably benign	Het
Rsf1	T	A	7: 97,636,407	W109R	probably damaging	Het
Sipa1l2	C	T	8: 125,449,876		probably null	Het
Tspan5	G	T	3: 138,898,348	V165L	probably damaging	Het
Uts2r	T	A	11: 121,161,465	V385E	probably benign	Het
Vma21-ps	T	A	4: 52,497,231	D5V	possibly damaging	Het
Vmn2r62	T	A	7: 42,789,016	N132I	probably damaging	Het
Zfp622	T	C	15: 25,991,579		probably benign	Het
Zmiz1	A	G	14: 25,655,247	K766R	probably damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TCAGTCACATGGTTCAGGTGAGGG -3'
(R):5'- AAAAGGTAGGTCCAAACGCTGACTC -3'

Sequencing Primer
(F):5'- AGGGCGGCTTCCCTTTC -3'
(R):5'- AACGCTGACTCCCTTAGTGATAG -3'

Posted On

2013-04-16