Mutagenetix > Incidental Mutation

Incidental Mutation 'R0144:Rnf213'

22521

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

038429-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0144 (G1)

Quality Score

207

Status

Validated (trace)

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 119479600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 4742 (K4742*)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035] [ENSMUST00000172235]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000093902
AA Change: K4743*

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: K4743*

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000131035
AA Change: K4742*

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: K4742*

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172235

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208476

Meta Mutation Damage Score

0.9704

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 87.0%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd4	T	A	12: 84,605,965 (GRCm38)		probably null	Het
Acp6	T	A	3: 97,165,829 (GRCm38)		probably benign	Het
AI661453	A	T	17: 47,469,299 (GRCm38)		probably benign	Het
Aox1	A	G	1: 58,070,074 (GRCm38)	I674V	probably benign	Het
Armc2	A	T	10: 41,947,887 (GRCm38)		probably benign	Het
Atp8b1	G	C	18: 64,571,374 (GRCm38)		probably benign	Het
Baz2b	A	T	2: 59,907,495 (GRCm38)	N1823K	probably damaging	Het
Bbx	C	T	16: 50,280,392 (GRCm38)	E47K	probably benign	Het
Brca1	A	T	11: 101,526,121 (GRCm38)	S396T	probably damaging	Het
Btnl6	G	T	17: 34,514,020 (GRCm38)	R290S	probably benign	Het
Casp8ap2	A	G	4: 32,643,797 (GRCm38)	R957G	possibly damaging	Het
Ccdc13	A	G	9: 121,827,351 (GRCm38)	L132P	probably damaging	Het
Ccdc187	A	G	2: 26,276,203 (GRCm38)	I738T	probably damaging	Het
Ccdc58	A	T	16: 36,085,114 (GRCm38)	N92I	possibly damaging	Het
Ceacam15	G	T	7: 16,673,191 (GRCm38)	H134N	probably benign	Het
Cep170	T	C	1: 176,792,595 (GRCm38)	I46V	probably benign	Het
Cfap57	T	C	4: 118,584,705 (GRCm38)	D722G	probably damaging	Het
Col11a1	A	T	3: 114,113,594 (GRCm38)	D628V	unknown	Het
Csmd1	A	T	8: 16,391,824 (GRCm38)	V342E	probably benign	Het
Dennd1a	A	G	2: 38,126,640 (GRCm38)	V64A	probably damaging	Het
Dlec1	G	T	9: 119,142,866 (GRCm38)	G1345V	probably benign	Het
Dnah1	G	A	14: 31,267,874 (GRCm38)		probably benign	Het
Dock5	C	T	14: 67,786,286 (GRCm38)	G1142D	probably benign	Het
Etv2	C	A	7: 30,634,883 (GRCm38)	A142S	probably benign	Het
Fam110c	C	A	12: 31,074,501 (GRCm38)	T154K	unknown	Het
Fbxo17	C	G	7: 28,735,340 (GRCm38)	D183E	probably damaging	Het
Fbxo30	T	A	10: 11,295,220 (GRCm38)	W681R	probably damaging	Het
Fig4	A	G	10: 41,258,049 (GRCm38)	Y413H	probably damaging	Het
Gab1	A	G	8: 80,785,201 (GRCm38)		probably benign	Het
Gabarapl1	T	C	6: 129,533,448 (GRCm38)	M1T	probably null	Het
Gm4763	A	G	7: 24,723,590 (GRCm38)	V101A	possibly damaging	Het
H2-M10.6	G	A	17: 36,812,241 (GRCm38)	C22Y	probably damaging	Het
Igfn1	T	C	1: 135,962,013 (GRCm38)	D2432G	probably damaging	Het
Il13	T	C	11: 53,633,176 (GRCm38)	D60G	possibly damaging	Het
Iqgap1	A	G	7: 80,751,920 (GRCm38)	L479P	probably damaging	Het
Itpr2	T	A	6: 146,327,155 (GRCm38)	Q1314L	probably damaging	Het
Jrk	C	T	15: 74,706,156 (GRCm38)	G427S	probably benign	Het
Kcnb1	T	G	2: 167,104,547 (GRCm38)	N794H	probably damaging	Het
Klhl8	A	T	5: 103,867,938 (GRCm38)	S361R	probably benign	Het
Krt87	T	C	15: 101,438,661 (GRCm38)	Y37C	probably benign	Het
Lbp	A	T	2: 158,319,710 (GRCm38)	S231C	probably damaging	Het
Lpin2	A	G	17: 71,225,076 (GRCm38)	E142G	probably damaging	Het
Lrch4	G	A	5: 137,638,543 (GRCm38)		probably null	Het
Manea	A	G	4: 26,340,719 (GRCm38)	M81T	probably benign	Het
Mcm3ap	A	G	10: 76,481,015 (GRCm38)	T618A	probably benign	Het
Me3	A	G	7: 89,739,872 (GRCm38)	D128G	probably damaging	Het
Mug2	A	G	6: 122,071,011 (GRCm38)		probably benign	Het
Myo9b	A	T	8: 71,346,043 (GRCm38)	Q901L	probably damaging	Het
Nalcn	C	T	14: 123,409,839 (GRCm38)		probably benign	Het
Nalcn	T	C	14: 123,371,536 (GRCm38)	R640G	probably damaging	Het
Ncor1	T	C	11: 62,392,595 (GRCm38)	N422S	probably damaging	Het
Nf1	T	A	11: 79,547,127 (GRCm38)	Y88N	probably damaging	Het
Nrxn3	G	A	12: 89,348,392 (GRCm38)	A358T	probably damaging	Het
Olfr1458	G	A	19: 13,103,278 (GRCm38)	R3C	possibly damaging	Het
Olfr486	T	C	7: 108,171,971 (GRCm38)	I258V	probably benign	Het
Olfr593	A	T	7: 103,212,540 (GRCm38)	I216F	probably damaging	Het
Phlpp2	C	T	8: 109,907,513 (GRCm38)	R242W	probably damaging	Het
Pld5	T	C	1: 175,970,541 (GRCm38)	N431D	probably benign	Het
Prss28	G	A	17: 25,309,450 (GRCm38)	V16M	probably damaging	Het
Psmd2	T	A	16: 20,662,225 (GRCm38)		probably null	Het
Ptpn21	A	T	12: 98,688,609 (GRCm38)	S700T	probably benign	Het
Rasa2	A	T	9: 96,592,019 (GRCm38)	V152D	probably damaging	Het
Reln	G	T	5: 21,948,449 (GRCm38)	R2286S	probably damaging	Het
Rflnb	G	T	11: 76,024,963 (GRCm38)	P102Q	probably damaging	Het
Rin2	G	A	2: 145,876,639 (GRCm38)	V680I	probably damaging	Het
Rpp40	A	T	13: 35,901,369 (GRCm38)	S143T	probably benign	Het
Rps12	A	G	10: 23,786,791 (GRCm38)	I51T	probably benign	Het
Rsf1	T	A	7: 97,636,407 (GRCm38)	W109R	probably damaging	Het
Sipa1l2	C	T	8: 125,449,876 (GRCm38)		probably null	Het
Tspan5	G	T	3: 138,898,348 (GRCm38)	V165L	probably damaging	Het
Uts2r	T	A	11: 121,161,465 (GRCm38)	V385E	probably benign	Het
Vma21-ps	T	A	4: 52,497,231 (GRCm38)	D5V	possibly damaging	Het
Vmn2r62	T	A	7: 42,789,016 (GRCm38)	N132I	probably damaging	Het
Zfp622	T	C	15: 25,991,579 (GRCm38)		probably benign	Het
Zmiz1	A	G	14: 25,655,247 (GRCm38)	K766R	probably damaging	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,449,343 (GRCm38)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,440,843 (GRCm38)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,447,237 (GRCm38)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,483,118 (GRCm38)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,443,300 (GRCm38)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,449,876 (GRCm38)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,436,352 (GRCm38)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,441,307 (GRCm38)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,442,266 (GRCm38)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,443,015 (GRCm38)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,416,457 (GRCm38)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,443,268 (GRCm38)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,418,309 (GRCm38)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,445,673 (GRCm38)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,440,650 (GRCm38)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,480,907 (GRCm38)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,463,336 (GRCm38)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,436,802 (GRCm38)	missense	probably benign
IGL02588:Rnf213	APN	11	119,416,536 (GRCm38)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,440,789 (GRCm38)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,435,066 (GRCm38)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,427,510 (GRCm38)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,479,941 (GRCm38)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,445,626 (GRCm38)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,441,087 (GRCm38)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,465,007 (GRCm38)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,474,172 (GRCm38)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,443,004 (GRCm38)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,421,468 (GRCm38)	missense	probably benign	0.34
attrition	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
defame	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
Derogate	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
dinky	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,434,742 (GRCm38)	missense
Impugn	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,426,069 (GRCm38)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
PIT4585001:Rnf213	UTSW	11	119,458,392 (GRCm38)	missense
R0008:Rnf213	UTSW	11	119,465,052 (GRCm38)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,441,606 (GRCm38)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,402,575 (GRCm38)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,414,587 (GRCm38)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,416,496 (GRCm38)	missense	probably benign	0.05
R0184:Rnf213	UTSW	11	119,414,521 (GRCm38)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,438,105 (GRCm38)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,426,111 (GRCm38)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,447,257 (GRCm38)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,426,012 (GRCm38)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,443,120 (GRCm38)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,465,082 (GRCm38)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,443,280 (GRCm38)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,431,717 (GRCm38)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,441,834 (GRCm38)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,441,150 (GRCm38)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,441,068 (GRCm38)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,473,480 (GRCm38)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,423,095 (GRCm38)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,430,486 (GRCm38)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,414,570 (GRCm38)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,416,563 (GRCm38)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,452,581 (GRCm38)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,485,998 (GRCm38)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,477,229 (GRCm38)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,435,983 (GRCm38)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,436,177 (GRCm38)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,436,005 (GRCm38)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,442,400 (GRCm38)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,437,750 (GRCm38)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,480,889 (GRCm38)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,441,888 (GRCm38)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,442,707 (GRCm38)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,441,839 (GRCm38)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,414,526 (GRCm38)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,436,611 (GRCm38)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,463,345 (GRCm38)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,442,579 (GRCm38)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,437,672 (GRCm38)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,440,221 (GRCm38)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,441,183 (GRCm38)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,450,129 (GRCm38)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,416,448 (GRCm38)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,431,685 (GRCm38)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,480,895 (GRCm38)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,441,107 (GRCm38)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,436,022 (GRCm38)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,461,918 (GRCm38)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,467,302 (GRCm38)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,442,663 (GRCm38)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,428,013 (GRCm38)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,450,201 (GRCm38)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,443,690 (GRCm38)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,415,193 (GRCm38)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,415,070 (GRCm38)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,460,009 (GRCm38)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,436,428 (GRCm38)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,414,604 (GRCm38)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,443,195 (GRCm38)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,459,938 (GRCm38)	splice site	probably null
R2698:Rnf213	UTSW	11	119,410,144 (GRCm38)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,468,892 (GRCm38)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,441,976 (GRCm38)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,479,558 (GRCm38)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R4014:Rnf213	UTSW	11	119,445,729 (GRCm38)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,482,448 (GRCm38)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,483,006 (GRCm38)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,409,482 (GRCm38)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,441,243 (GRCm38)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,483,964 (GRCm38)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,479,670 (GRCm38)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,437,695 (GRCm38)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,441,125 (GRCm38)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,440,349 (GRCm38)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,445,745 (GRCm38)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,416,629 (GRCm38)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,442,763 (GRCm38)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,481,240 (GRCm38)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,428,157 (GRCm38)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,436,764 (GRCm38)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,410,807 (GRCm38)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,458,866 (GRCm38)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,440,816 (GRCm38)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,440,808 (GRCm38)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,409,020 (GRCm38)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,415,076 (GRCm38)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,433,499 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,905 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,629 (GRCm38)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,458,785 (GRCm38)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,434,686 (GRCm38)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,483,894 (GRCm38)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,436,295 (GRCm38)	missense	probably benign
R5861:Rnf213	UTSW	11	119,473,377 (GRCm38)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,421,369 (GRCm38)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,443,079 (GRCm38)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,486,010 (GRCm38)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,442,101 (GRCm38)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,416,559 (GRCm38)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,411,513 (GRCm38)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,411,470 (GRCm38)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,442,028 (GRCm38)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,435,999 (GRCm38)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,458,428 (GRCm38)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,414,548 (GRCm38)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,463,366 (GRCm38)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,477,078 (GRCm38)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,459,966 (GRCm38)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,452,687 (GRCm38)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,436,280 (GRCm38)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,479,920 (GRCm38)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,442,271 (GRCm38)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,462,285 (GRCm38)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,448,838 (GRCm38)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,449,866 (GRCm38)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,479,655 (GRCm38)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,437,604 (GRCm38)	splice site	probably null
R7170:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7185:Rnf213	UTSW	11	119,424,198 (GRCm38)	missense
R7239:Rnf213	UTSW	11	119,458,788 (GRCm38)	missense
R7258:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7259:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7260:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7273:Rnf213	UTSW	11	119,431,756 (GRCm38)	splice site	probably null
R7282:Rnf213	UTSW	11	119,437,992 (GRCm38)	missense
R7311:Rnf213	UTSW	11	119,416,547 (GRCm38)	missense
R7352:Rnf213	UTSW	11	119,443,579 (GRCm38)	missense
R7369:Rnf213	UTSW	11	119,430,468 (GRCm38)	missense
R7410:Rnf213	UTSW	11	119,435,051 (GRCm38)	missense
R7448:Rnf213	UTSW	11	119,481,291 (GRCm38)	missense
R7561:Rnf213	UTSW	11	119,441,719 (GRCm38)	missense
R7573:Rnf213	UTSW	11	119,458,484 (GRCm38)	missense
R7615:Rnf213	UTSW	11	119,467,297 (GRCm38)	missense
R7680:Rnf213	UTSW	11	119,479,556 (GRCm38)	missense
R7739:Rnf213	UTSW	11	119,410,861 (GRCm38)	missense
R7789:Rnf213	UTSW	11	119,470,219 (GRCm38)	splice site	probably null
R7806:Rnf213	UTSW	11	119,411,545 (GRCm38)	missense
R8031:Rnf213	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,441,654 (GRCm38)	missense
R8053:Rnf213	UTSW	11	119,402,647 (GRCm38)	missense
R8284:Rnf213	UTSW	11	119,428,083 (GRCm38)	missense
R8301:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
R8325:Rnf213	UTSW	11	119,430,445 (GRCm38)	missense
R8332:Rnf213	UTSW	11	119,483,698 (GRCm38)	missense
R8443:Rnf213	UTSW	11	119,449,323 (GRCm38)	missense
R8518:Rnf213	UTSW	11	119,462,217 (GRCm38)	missense
R8531:Rnf213	UTSW	11	119,474,205 (GRCm38)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,458,737 (GRCm38)	missense
R8675:Rnf213	UTSW	11	119,456,158 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,441,212 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,418,129 (GRCm38)	missense
R8714:Rnf213	UTSW	11	119,468,894 (GRCm38)	missense
R8802:Rnf213	UTSW	11	119,462,102 (GRCm38)	missense
R8861:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense
R8886:Rnf213	UTSW	11	119,473,438 (GRCm38)	missense
R8893:Rnf213	UTSW	11	119,443,042 (GRCm38)	missense
R8937:Rnf213	UTSW	11	119,430,274 (GRCm38)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,414,424 (GRCm38)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,461,930 (GRCm38)	missense
R8983:Rnf213	UTSW	11	119,430,349 (GRCm38)	missense
R9043:Rnf213	UTSW	11	119,458,913 (GRCm38)	missense
R9081:Rnf213	UTSW	11	119,466,236 (GRCm38)	missense
R9132:Rnf213	UTSW	11	119,483,916 (GRCm38)	missense
R9135:Rnf213	UTSW	11	119,408,747 (GRCm38)	missense
R9146:Rnf213	UTSW	11	119,443,673 (GRCm38)	missense
R9156:Rnf213	UTSW	11	119,440,748 (GRCm38)	missense
R9183:Rnf213	UTSW	11	119,427,622 (GRCm38)	missense
R9234:Rnf213	UTSW	11	119,450,117 (GRCm38)	missense
R9275:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9278:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9296:Rnf213	UTSW	11	119,443,795 (GRCm38)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,442,149 (GRCm38)	missense
R9366:Rnf213	UTSW	11	119,436,231 (GRCm38)	missense
R9413:Rnf213	UTSW	11	119,466,233 (GRCm38)	missense
R9444:Rnf213	UTSW	11	119,434,797 (GRCm38)	missense
R9464:Rnf213	UTSW	11	119,463,580 (GRCm38)	missense
R9605:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R9649:Rnf213	UTSW	11	119,479,631 (GRCm38)	missense
R9651:Rnf213	UTSW	11	119,440,412 (GRCm38)	missense
R9664:Rnf213	UTSW	11	119,441,968 (GRCm38)	missense
R9696:Rnf213	UTSW	11	119,468,980 (GRCm38)	missense
R9710:Rnf213	UTSW	11	119,441,005 (GRCm38)	missense
R9797:Rnf213	UTSW	11	119,442,539 (GRCm38)	missense
S24628:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,441,824 (GRCm38)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,473,513 (GRCm38)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,440,463 (GRCm38)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,477,254 (GRCm38)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,482,998 (GRCm38)	missense
Z1176:Rnf213	UTSW	11	119,441,410 (GRCm38)	missense

Predicted Primers

PCR Primer
(F):5'- ACCCATTGGGTTTTGGCACACAG -3'
(R):5'- CAGCCATGTTCCGACTCATAGCAG -3'

Sequencing Primer
(F):5'- AGAATGAGATGGCCCTTTACCTC -3'
(R):5'- GACTCATAGCAGCTCTGCC -3'

Posted On

2013-04-16