Incidental Mutation 'R2043:Piwil2'
ID225237
Institutional Source Beutler Lab
Gene Symbol Piwil2
Ensembl Gene ENSMUSG00000033644
Gene Namepiwi-like RNA-mediated gene silencing 2
SynonymsMiwi like, mili
MMRRC Submission 040050-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2043 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70372477-70429383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70391470 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 699 (V699A)
Ref Sequence ENSEMBL: ENSMUSP00000047385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048129]
PDB Structure
Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048129
AA Change: V699A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047385
Gene: ENSMUSG00000033644
AA Change: V699A

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
DUF1785 335 386 7.44e-2 SMART
PAZ 386 524 1.92e-62 SMART
Piwi 666 957 2.45e-119 SMART
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testis weight, azoospermia, and male infertility associated with a complete arrest of spermatogenesis and increased apoptotic cell death during the early prophase of the first meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A G 8: 24,996,653 probably null Het
Adnp2 A C 18: 80,128,326 M956R probably damaging Het
Aldh1l1 T A 6: 90,557,332 D36E probably benign Het
Ankmy1 T C 1: 92,876,527 probably benign Het
Apaf1 T C 10: 91,037,028 D718G probably damaging Het
Ascc3 C T 10: 50,700,520 P857L probably damaging Het
Atp8b1 T C 18: 64,605,200 K60R possibly damaging Het
Bub1 A T 2: 127,804,220 C947S probably damaging Het
Cacna1c C T 6: 118,596,088 G2017D probably benign Het
Capn3 A G 2: 120,491,901 N414S possibly damaging Het
Ccdc110 T C 8: 45,942,827 M585T probably benign Het
Cep85l A T 10: 53,358,128 N51K possibly damaging Het
Cftr T C 6: 18,320,935 F1415L probably benign Het
Cln5 T C 14: 103,075,944 S211P probably damaging Het
Dcaf5 A T 12: 80,340,217 D378E probably benign Het
Dhx57 A G 17: 80,253,080 probably benign Het
Dsn1 G A 2: 157,005,353 S55L possibly damaging Het
Eif5b T C 1: 38,041,819 F747S probably damaging Het
Fam189b A G 3: 89,185,567 Y251C probably damaging Het
Fbxo25 A G 8: 13,921,905 I86V probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glcci1 T A 6: 8,582,590 I130K probably damaging Het
Gm5424 A G 10: 62,071,211 noncoding transcript Het
Gsdma G A 11: 98,666,220 V54M possibly damaging Het
Heatr3 T A 8: 88,147,694 probably benign Het
Hist1h3c A G 13: 23,745,295 F68S probably damaging Het
Hspa13 A G 16: 75,758,268 L310S probably benign Het
Il6st A C 13: 112,480,219 Q100P probably benign Het
Ly6g6e G A 17: 35,077,864 R27Q possibly damaging Het
Mis18bp1 A T 12: 65,149,418 I524K probably damaging Het
Myo18a T C 11: 77,823,363 I761T probably damaging Het
Mypop T C 7: 19,001,019 probably benign Het
Olfr610 A G 7: 103,506,943 M1T probably null Het
Pcdh20 G A 14: 88,467,155 T903I probably benign Het
Pdk4 A T 6: 5,485,502 C396S probably benign Het
Plekha5 T C 6: 140,552,804 probably benign Het
Ralgapa1 T A 12: 55,677,026 I1572L probably damaging Het
Rasgrf2 T A 13: 92,030,843 M241L possibly damaging Het
Ryr1 C T 7: 29,059,631 R3374H probably damaging Het
Slc24a2 A T 4: 86,996,645 M519K probably damaging Het
Smg9 T A 7: 24,405,576 I67N possibly damaging Het
Spg20 G A 3: 55,127,548 A452T probably damaging Het
Ush2a T A 1: 188,916,256 F4686Y probably benign Het
Zfp146 T C 7: 30,162,239 K126R possibly damaging Het
Zfp386 T A 12: 116,059,161 D131E probably benign Het
Zfp423 T C 8: 87,782,618 D366G probably damaging Het
Zfp729a T C 13: 67,621,172 K313E probably damaging Het
Zfp955a G A 17: 33,242,553 H202Y possibly damaging Het
Other mutations in Piwil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Piwil2 APN 14 70398218 missense probably benign 0.35
IGL02215:Piwil2 APN 14 70391373 missense possibly damaging 0.50
IGL02427:Piwil2 APN 14 70398134 splice site probably benign
IGL02554:Piwil2 APN 14 70391486 splice site probably benign
R0257:Piwil2 UTSW 14 70422631 missense probably benign 0.00
R0566:Piwil2 UTSW 14 70410394 missense probably damaging 0.99
R0800:Piwil2 UTSW 14 70409037 unclassified probably benign
R0828:Piwil2 UTSW 14 70376017 missense probably damaging 1.00
R0862:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0864:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0881:Piwil2 UTSW 14 70408927 missense probably benign 0.34
R1734:Piwil2 UTSW 14 70426505 critical splice donor site probably null
R1997:Piwil2 UTSW 14 70426658 missense possibly damaging 0.90
R2011:Piwil2 UTSW 14 70426634 missense probably damaging 1.00
R2347:Piwil2 UTSW 14 70408917 missense probably damaging 0.98
R2998:Piwil2 UTSW 14 70411238 missense probably damaging 1.00
R4402:Piwil2 UTSW 14 70408916 missense probably benign 0.01
R4455:Piwil2 UTSW 14 70390565 missense probably benign 0.02
R4611:Piwil2 UTSW 14 70402197 missense probably benign 0.07
R4763:Piwil2 UTSW 14 70376778 missense probably damaging 1.00
R4869:Piwil2 UTSW 14 70395362 missense probably benign 0.00
R5033:Piwil2 UTSW 14 70421593 missense possibly damaging 0.71
R5207:Piwil2 UTSW 14 70392517 missense probably damaging 1.00
R5395:Piwil2 UTSW 14 70395397 missense probably benign 0.01
R5486:Piwil2 UTSW 14 70401431 missense probably benign 0.01
R5504:Piwil2 UTSW 14 70389899 missense probably benign 0.01
R5629:Piwil2 UTSW 14 70422967 missense probably damaging 1.00
R5967:Piwil2 UTSW 14 70390564 missense probably benign 0.00
R6167:Piwil2 UTSW 14 70422893 critical splice donor site probably null
R6168:Piwil2 UTSW 14 70395351 missense probably benign 0.04
R6517:Piwil2 UTSW 14 70374336 missense probably benign 0.44
R7261:Piwil2 UTSW 14 70374411 missense probably damaging 1.00
R7727:Piwil2 UTSW 14 70394057 missense probably damaging 1.00
R7745:Piwil2 UTSW 14 70394189 missense probably benign
R7833:Piwil2 UTSW 14 70395441 missense probably benign 0.02
R7916:Piwil2 UTSW 14 70395441 missense probably benign 0.02
R8044:Piwil2 UTSW 14 70391438 missense possibly damaging 0.90
R8066:Piwil2 UTSW 14 70420719 missense probably benign 0.00
X0023:Piwil2 UTSW 14 70398199 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGAGCAACACAGTGACAG -3'
(R):5'- ATAGTACACTCAGTCCTCACTATTAG -3'

Sequencing Primer
(F):5'- GCAACACAGTGACAGCAGAGC -3'
(R):5'- AAGTCCTGGCGTTACAAGTC -3'
Posted On2014-08-25