Incidental Mutation 'R2043:Fpr-rs4'
ID225245
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Nameformyl peptide receptor, related sequence 4
Synonyms
MMRRC Submission 040050-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2043 (G1)
Quality Score217
Status Validated
Chromosome17
Chromosomal Location18021733-18022704 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGGAA to CA at 18022334 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
Predicted Effect probably null
Transcript: ENSMUST00000095651
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A G 8: 24,996,653 probably null Het
Adnp2 A C 18: 80,128,326 M956R probably damaging Het
Aldh1l1 T A 6: 90,557,332 D36E probably benign Het
Ankmy1 T C 1: 92,876,527 probably benign Het
Apaf1 T C 10: 91,037,028 D718G probably damaging Het
Ascc3 C T 10: 50,700,520 P857L probably damaging Het
Atp8b1 T C 18: 64,605,200 K60R possibly damaging Het
Bub1 A T 2: 127,804,220 C947S probably damaging Het
Cacna1c C T 6: 118,596,088 G2017D probably benign Het
Capn3 A G 2: 120,491,901 N414S possibly damaging Het
Ccdc110 T C 8: 45,942,827 M585T probably benign Het
Cep85l A T 10: 53,358,128 N51K possibly damaging Het
Cftr T C 6: 18,320,935 F1415L probably benign Het
Cln5 T C 14: 103,075,944 S211P probably damaging Het
Dcaf5 A T 12: 80,340,217 D378E probably benign Het
Dhx57 A G 17: 80,253,080 probably benign Het
Dsn1 G A 2: 157,005,353 S55L possibly damaging Het
Eif5b T C 1: 38,041,819 F747S probably damaging Het
Fam189b A G 3: 89,185,567 Y251C probably damaging Het
Fbxo25 A G 8: 13,921,905 I86V probably damaging Het
Glcci1 T A 6: 8,582,590 I130K probably damaging Het
Gm5424 A G 10: 62,071,211 noncoding transcript Het
Gsdma G A 11: 98,666,220 V54M possibly damaging Het
Heatr3 T A 8: 88,147,694 probably benign Het
Hist1h3c A G 13: 23,745,295 F68S probably damaging Het
Hspa13 A G 16: 75,758,268 L310S probably benign Het
Il6st A C 13: 112,480,219 Q100P probably benign Het
Ly6g6e G A 17: 35,077,864 R27Q possibly damaging Het
Mis18bp1 A T 12: 65,149,418 I524K probably damaging Het
Myo18a T C 11: 77,823,363 I761T probably damaging Het
Mypop T C 7: 19,001,019 probably benign Het
Olfr610 A G 7: 103,506,943 M1T probably null Het
Pcdh20 G A 14: 88,467,155 T903I probably benign Het
Pdk4 A T 6: 5,485,502 C396S probably benign Het
Piwil2 A G 14: 70,391,470 V699A probably benign Het
Plekha5 T C 6: 140,552,804 probably benign Het
Ralgapa1 T A 12: 55,677,026 I1572L probably damaging Het
Rasgrf2 T A 13: 92,030,843 M241L possibly damaging Het
Ryr1 C T 7: 29,059,631 R3374H probably damaging Het
Slc24a2 A T 4: 86,996,645 M519K probably damaging Het
Smg9 T A 7: 24,405,576 I67N possibly damaging Het
Spg20 G A 3: 55,127,548 A452T probably damaging Het
Ush2a T A 1: 188,916,256 F4686Y probably benign Het
Zfp146 T C 7: 30,162,239 K126R possibly damaging Het
Zfp386 T A 12: 116,059,161 D131E probably benign Het
Zfp423 T C 8: 87,782,618 D366G probably damaging Het
Zfp729a T C 13: 67,621,172 K313E probably damaging Het
Zfp955a G A 17: 33,242,553 H202Y possibly damaging Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R0686:Fpr-rs4 UTSW 17 18022351 missense probably benign 0.05
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2093:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6076:Fpr-rs4 UTSW 17 18022055 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6639:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R6757:Fpr-rs4 UTSW 17 18022132 nonsense probably null
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCAGAAAAGTGGTTCTTGGAGC -3'
(R):5'- GCCAAGGTATTTGCTGGGTTAAC -3'

Sequencing Primer
(F):5'- AGCTTGGATATTTGCTCTGCTGC -3'
(R):5'- GCTCAGTGTCTCATTGTTAAAGATG -3'
Posted On2014-08-25