Incidental Mutation 'R2043:Dhx57'
ID225251
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene NameDEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission 040050-MU
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R2043 (G1)
Quality Score214
Status Validated
Chromosome17
Chromosomal Location80238304-80290476 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 80253080 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
Predicted Effect probably benign
Transcript: ENSMUST00000038166
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086555
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (47/49)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A G 8: 24,996,653 probably null Het
Adnp2 A C 18: 80,128,326 M956R probably damaging Het
Aldh1l1 T A 6: 90,557,332 D36E probably benign Het
Ankmy1 T C 1: 92,876,527 probably benign Het
Apaf1 T C 10: 91,037,028 D718G probably damaging Het
Ascc3 C T 10: 50,700,520 P857L probably damaging Het
Atp8b1 T C 18: 64,605,200 K60R possibly damaging Het
Bub1 A T 2: 127,804,220 C947S probably damaging Het
Cacna1c C T 6: 118,596,088 G2017D probably benign Het
Capn3 A G 2: 120,491,901 N414S possibly damaging Het
Ccdc110 T C 8: 45,942,827 M585T probably benign Het
Cep85l A T 10: 53,358,128 N51K possibly damaging Het
Cftr T C 6: 18,320,935 F1415L probably benign Het
Cln5 T C 14: 103,075,944 S211P probably damaging Het
Dcaf5 A T 12: 80,340,217 D378E probably benign Het
Dsn1 G A 2: 157,005,353 S55L possibly damaging Het
Eif5b T C 1: 38,041,819 F747S probably damaging Het
Fam189b A G 3: 89,185,567 Y251C probably damaging Het
Fbxo25 A G 8: 13,921,905 I86V probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glcci1 T A 6: 8,582,590 I130K probably damaging Het
Gm5424 A G 10: 62,071,211 noncoding transcript Het
Gsdma G A 11: 98,666,220 V54M possibly damaging Het
Heatr3 T A 8: 88,147,694 probably benign Het
Hist1h3c A G 13: 23,745,295 F68S probably damaging Het
Hspa13 A G 16: 75,758,268 L310S probably benign Het
Il6st A C 13: 112,480,219 Q100P probably benign Het
Ly6g6e G A 17: 35,077,864 R27Q possibly damaging Het
Mis18bp1 A T 12: 65,149,418 I524K probably damaging Het
Myo18a T C 11: 77,823,363 I761T probably damaging Het
Mypop T C 7: 19,001,019 probably benign Het
Olfr610 A G 7: 103,506,943 M1T probably null Het
Pcdh20 G A 14: 88,467,155 T903I probably benign Het
Pdk4 A T 6: 5,485,502 C396S probably benign Het
Piwil2 A G 14: 70,391,470 V699A probably benign Het
Plekha5 T C 6: 140,552,804 probably benign Het
Ralgapa1 T A 12: 55,677,026 I1572L probably damaging Het
Rasgrf2 T A 13: 92,030,843 M241L possibly damaging Het
Ryr1 C T 7: 29,059,631 R3374H probably damaging Het
Slc24a2 A T 4: 86,996,645 M519K probably damaging Het
Smg9 T A 7: 24,405,576 I67N possibly damaging Het
Spg20 G A 3: 55,127,548 A452T probably damaging Het
Ush2a T A 1: 188,916,256 F4686Y probably benign Het
Zfp146 T C 7: 30,162,239 K126R possibly damaging Het
Zfp386 T A 12: 116,059,161 D131E probably benign Het
Zfp423 T C 8: 87,782,618 D366G probably damaging Het
Zfp729a T C 13: 67,621,172 K313E probably damaging Het
Zfp955a G A 17: 33,242,553 H202Y possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTTCTTGAGGATGTGAAAGTCTC -3'
(R):5'- CCTTTCCAGATACGACGCAG -3'

Sequencing Primer
(F):5'- ATGTGAAAGTCTCTGTGTGCAG -3'
(R):5'- AGTCTAGAGGACACGTTCGTG -3'
Posted On2014-08-25