Incidental Mutation 'R1991:Serpind1'
ID 225255
Institutional Source Beutler Lab
Gene Symbol Serpind1
Ensembl Gene ENSMUSG00000022766
Gene Name serine (or cysteine) peptidase inhibitor, clade D, member 1
Synonyms HC II, heparin cofactor II, Hcf2, HCII
MMRRC Submission 040002-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1991 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 17149235-17161438 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17160808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 446 (V446A)
Ref Sequence ENSEMBL: ENSMUSP00000156303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023450] [ENSMUST00000036161] [ENSMUST00000161034] [ENSMUST00000231884] [ENSMUST00000232232]
AlphaFold P49182
Predicted Effect probably benign
Transcript: ENSMUST00000023450
AA Change: V446A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023450
Gene: ENSMUSG00000022766
AA Change: V446A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
SERPIN 114 475 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036161
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132300
Predicted Effect probably benign
Transcript: ENSMUST00000161034
AA Change: V446A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125507
Gene: ENSMUSG00000022766
AA Change: V446A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
SERPIN 114 475 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231884
AA Change: V446A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232232
Predicted Effect probably benign
Transcript: ENSMUST00000232404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231961
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (124/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the serpin gene superfamily. Serpins play roles in many processes including inflammation, blood clotting, and cancer metastasis. Members of this family have highly conserved secondary structures with a reactive center loop that interacts with the protease active site to inhibit protease activity. This gene encodes a plasma serine protease that functions as a thrombin and chymotrypsin inhibitor. The protein is activated by heparin, dermatan sulfate, and glycosaminoglycans. Allelic variations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,771,419 (GRCm39) R203* probably null Het
Abcc2 A T 19: 43,795,581 (GRCm39) I446F probably damaging Het
Afap1l2 A T 19: 56,990,699 (GRCm39) I18N possibly damaging Het
Aida A T 1: 183,094,627 (GRCm39) E107D probably benign Het
Amer2 A G 14: 60,617,269 (GRCm39) Y362C probably damaging Het
Amigo1 T C 3: 108,094,644 (GRCm39) S48P probably benign Het
Ano5 A G 7: 51,187,561 (GRCm39) K50R possibly damaging Het
Anxa2 A T 9: 69,391,098 (GRCm39) D95V probably damaging Het
Arhgap22 A G 14: 33,088,916 (GRCm39) N466D probably damaging Het
Armc3 T C 2: 19,297,953 (GRCm39) Y575H probably damaging Het
Ascc2 A G 11: 4,629,257 (GRCm39) E523G probably benign Het
B3galt5 A T 16: 96,117,225 (GRCm39) K286M probably damaging Het
Bag3 C T 7: 128,147,407 (GRCm39) H341Y probably benign Het
Blm G T 7: 80,155,697 (GRCm39) probably null Het
Cacna1b G A 2: 24,622,318 (GRCm39) P222L probably damaging Het
Cap2 T A 13: 46,791,357 (GRCm39) Y175N possibly damaging Het
Cd81 G T 7: 142,620,938 (GRCm39) G206* probably null Het
Cep290 T A 10: 100,367,046 (GRCm39) S1132R possibly damaging Het
Cluh C A 11: 74,550,355 (GRCm39) C222* probably null Het
Col14a1 A T 15: 55,313,336 (GRCm39) D1320V unknown Het
Col18a1 T C 10: 76,916,988 (GRCm39) I114V unknown Het
Cped1 A G 6: 22,233,926 (GRCm39) T847A probably damaging Het
Cpne7 A G 8: 123,854,176 (GRCm39) K288E possibly damaging Het
Cr2 G A 1: 194,836,458 (GRCm39) P1278S possibly damaging Het
Creb3 C A 4: 43,565,327 (GRCm39) R202S probably damaging Het
Cyp2j9 T A 4: 96,460,201 (GRCm39) K434M probably damaging Het
Dnai3 G T 3: 145,769,235 (GRCm39) T522K possibly damaging Het
Dpp10 A T 1: 123,832,833 (GRCm39) V48E probably null Het
Dsg2 A G 18: 20,734,530 (GRCm39) K836R probably damaging Het
Dst A G 1: 34,229,339 (GRCm39) T1986A probably benign Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Ecm2 A G 13: 49,683,732 (GRCm39) D570G probably benign Het
Efhc1 T A 1: 21,059,784 (GRCm39) C611* probably null Het
Epop T C 11: 97,519,480 (GRCm39) T210A probably benign Het
Erc2 A G 14: 27,733,593 (GRCm39) I556V probably benign Het
Fdxacb1 A T 9: 50,682,946 (GRCm39) N101I probably benign Het
Fhad1 T C 4: 141,709,473 (GRCm39) S294G possibly damaging Het
Galnt16 A G 12: 80,630,430 (GRCm39) D262G probably damaging Het
Gorab A G 1: 163,224,625 (GRCm39) S59P probably damaging Het
Gpr161 G T 1: 165,134,132 (GRCm39) M131I probably damaging Het
Gpr22 T A 12: 31,759,202 (GRCm39) M270L probably benign Het
Grin3b C A 10: 79,806,746 (GRCm39) Q5K probably benign Het
Grin3b C T 10: 79,810,480 (GRCm39) A662V probably damaging Het
Gsdmc A G 15: 63,673,748 (GRCm39) I179T probably benign Het
Gsdmc2 T A 15: 63,700,086 (GRCm39) M229L probably benign Het
H2-Eb2 A G 17: 34,553,278 (GRCm39) I155V probably benign Het
Hoga1 A C 19: 42,048,459 (GRCm39) probably null Het
Hs3st5 A G 10: 36,708,882 (GRCm39) Y139C probably damaging Het
Il10ra C A 9: 45,167,109 (GRCm39) A481S probably benign Het
Ints2 T A 11: 86,139,760 (GRCm39) H278L possibly damaging Het
Kalrn T G 16: 33,796,108 (GRCm39) L1222F probably damaging Het
Klhl25 T A 7: 75,516,480 (GRCm39) V157D probably damaging Het
Klk1b26 A T 7: 43,666,324 (GRCm39) T256S probably damaging Het
Krt81 T C 15: 101,360,435 (GRCm39) Q184R probably benign Het
Lce1k A T 3: 92,714,125 (GRCm39) C20S unknown Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lin54 A G 5: 100,633,660 (GRCm39) probably null Het
Lrrc37a T C 11: 103,391,087 (GRCm39) E1446G probably benign Het
Macf1 A G 4: 123,350,488 (GRCm39) S3792P probably damaging Het
Manba T A 3: 135,256,952 (GRCm39) D538E probably benign Het
Mcc C A 18: 44,624,382 (GRCm39) E213* probably null Het
Mfap4 T C 11: 61,376,633 (GRCm39) probably null Het
Muc21 A T 17: 35,929,600 (GRCm39) S1529T probably benign Het
Nebl T A 2: 17,457,321 (GRCm39) I80F probably damaging Het
Nek4 A G 14: 30,678,910 (GRCm39) I145V probably damaging Het
Nlrp14 T C 7: 106,795,407 (GRCm39) V230A probably benign Het
Nxf3 G A X: 134,976,583 (GRCm39) P380S possibly damaging Het
Or11h6 G A 14: 50,880,323 (GRCm39) C195Y possibly damaging Het
Or1a1 T C 11: 74,086,989 (GRCm39) V220A probably damaging Het
Or5b99 T C 19: 12,976,866 (GRCm39) V172A possibly damaging Het
Or5p66 C A 7: 107,885,566 (GRCm39) G256* probably null Het
Or6k8-ps1 C T 1: 173,979,687 (GRCm39) H202Y probably damaging Het
Pcdhb13 C T 18: 37,576,912 (GRCm39) T430I possibly damaging Het
Piezo2 A T 18: 63,207,733 (GRCm39) L1426Q probably null Het
Pigk T A 3: 152,450,131 (GRCm39) Y212N probably damaging Het
Pigm T G 1: 172,204,828 (GRCm39) L188R probably damaging Het
Plce1 T C 19: 38,766,368 (GRCm39) F2117S probably damaging Het
Plec A G 15: 76,057,743 (GRCm39) F4055L probably damaging Het
Plk5 C T 10: 80,198,936 (GRCm39) S435L possibly damaging Het
Pms1 G A 1: 53,321,201 (GRCm39) L11F probably damaging Het
Prl3b1 C T 13: 27,431,895 (GRCm39) T140I possibly damaging Het
Prl7a1 T G 13: 27,817,655 (GRCm39) D203A probably damaging Het
Psg17 A G 7: 18,548,577 (GRCm39) V398A probably benign Het
Pum1 T A 4: 130,445,529 (GRCm39) I166K possibly damaging Het
R3hdm1 T A 1: 128,096,753 (GRCm39) D108E probably damaging Het
Reln A T 5: 22,174,358 (GRCm39) D1948E possibly damaging Het
Rnf112 C T 11: 61,343,252 (GRCm39) R141Q probably damaging Het
Rnf145 T C 11: 44,452,293 (GRCm39) V424A possibly damaging Het
Serpina3m C A 12: 104,355,958 (GRCm39) Y208* probably null Het
Shc3 T A 13: 51,596,872 (GRCm39) M384L probably benign Het
Slc38a11 A G 2: 65,160,683 (GRCm39) F304L probably benign Het
Slpi C T 2: 164,197,463 (GRCm39) C28Y probably damaging Het
Specc1 C A 11: 61,920,120 (GRCm39) P7T possibly damaging Het
Spib T C 7: 44,178,281 (GRCm39) E180G probably benign Het
Spint5 T C 2: 164,558,903 (GRCm39) probably benign Het
Ssr2 T A 3: 88,484,174 (GRCm39) probably benign Het
Tbrg1 T C 9: 37,560,715 (GRCm39) D387G probably benign Het
Tex14 T G 11: 87,440,296 (GRCm39) L1367R probably damaging Het
Tfpi A C 2: 84,288,360 (GRCm39) probably benign Het
Tlr5 T A 1: 182,801,912 (GRCm39) D405E probably damaging Het
Tnnt3 C T 7: 142,065,262 (GRCm39) R131C possibly damaging Het
Tnxb T C 17: 34,890,878 (GRCm39) V407A probably damaging Het
Tnxb A G 17: 34,901,225 (GRCm39) Y1013C probably damaging Het
Tpx2 T A 2: 152,732,544 (GRCm39) M606K probably benign Het
Trim30a T A 7: 104,079,437 (GRCm39) probably benign Het
Trim46 A T 3: 89,145,008 (GRCm39) Y489N probably damaging Het
Trpm6 A T 19: 18,773,648 (GRCm39) H380L probably benign Het
Tstd2 A G 4: 46,120,563 (GRCm39) I279T probably benign Het
Ttn C T 2: 76,776,735 (GRCm39) probably null Het
Txnl1 T C 18: 63,812,585 (GRCm39) T70A probably benign Het
Ush2a C T 1: 188,310,729 (GRCm39) probably benign Het
Usp1 A G 4: 98,822,531 (GRCm39) D615G probably benign Het
Virma T A 4: 11,519,242 (GRCm39) C830S probably benign Het
Vmn1r7 A T 6: 57,001,853 (GRCm39) S136T probably benign Het
Vmn2r9 A G 5: 108,994,305 (GRCm39) V448A probably damaging Het
Vps11 G A 9: 44,270,524 (GRCm39) H183Y probably damaging Het
Vsig10l A G 7: 43,116,892 (GRCm39) T476A possibly damaging Het
Whamm C T 7: 81,241,519 (GRCm39) R277* probably null Het
Wnt8a A G 18: 34,677,937 (GRCm39) D115G probably damaging Het
Xndc1 T A 7: 101,722,398 (GRCm39) V21E probably damaging Het
Zc3hav1 C A 6: 38,313,452 (GRCm39) V198L probably damaging Het
Zfp874a T A 13: 67,590,623 (GRCm39) I354F probably benign Het
Zfr2 A T 10: 81,078,686 (GRCm39) D306V possibly damaging Het
Other mutations in Serpind1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Serpind1 APN 16 17,154,787 (GRCm39) missense probably benign 0.00
R1433:Serpind1 UTSW 16 17,160,249 (GRCm39) missense probably damaging 1.00
R1839:Serpind1 UTSW 16 17,160,856 (GRCm39) missense probably damaging 1.00
R2103:Serpind1 UTSW 16 17,160,808 (GRCm39) missense probably benign 0.00
R2937:Serpind1 UTSW 16 17,154,972 (GRCm39) missense probably benign 0.01
R4774:Serpind1 UTSW 16 17,154,272 (GRCm39) missense probably benign
R5233:Serpind1 UTSW 16 17,154,758 (GRCm39) missense probably damaging 1.00
R5493:Serpind1 UTSW 16 17,157,902 (GRCm39) missense probably damaging 1.00
R5713:Serpind1 UTSW 16 17,154,851 (GRCm39) missense probably damaging 1.00
R5720:Serpind1 UTSW 16 17,157,696 (GRCm39) missense probably benign 0.02
R7553:Serpind1 UTSW 16 17,154,539 (GRCm39) missense probably benign 0.00
R8311:Serpind1 UTSW 16 17,160,730 (GRCm39) missense possibly damaging 0.72
R8402:Serpind1 UTSW 16 17,154,949 (GRCm39) missense probably benign
R8531:Serpind1 UTSW 16 17,160,847 (GRCm39) missense probably damaging 1.00
R9468:Serpind1 UTSW 16 17,154,179 (GRCm39) missense possibly damaging 0.81
R9539:Serpind1 UTSW 16 17,157,638 (GRCm39) nonsense probably null
R9648:Serpind1 UTSW 16 17,154,318 (GRCm39) missense probably benign 0.18
X0020:Serpind1 UTSW 16 17,154,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGATTAGTCTCTGGAGC -3'
(R):5'- GCAAAATAGCTCTGTCCTCTTTG -3'

Sequencing Primer
(F):5'- GAGTCTTCAGCAGATACTCAATCTC -3'
(R):5'- ATAGCTCTGTCCTCTTTGTTAGAATG -3'
Posted On 2014-08-25