Incidental Mutation 'R1991:Kalrn'
ID 225257
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms E530005C20Rik, LOC224126, Hapip, 2210407G14Rik
MMRRC Submission 040002-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # R1991 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 33789443-34393647 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 33796108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1222 (L1222F)
Ref Sequence ENSEMBL: ENSMUSP00000110624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114973]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: L2891F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: L2891F

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114973
AA Change: L1222F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: L1222F

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132002
Meta Mutation Damage Score 0.1407 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (124/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,771,419 (GRCm39) R203* probably null Het
Abcc2 A T 19: 43,795,581 (GRCm39) I446F probably damaging Het
Afap1l2 A T 19: 56,990,699 (GRCm39) I18N possibly damaging Het
Aida A T 1: 183,094,627 (GRCm39) E107D probably benign Het
Amer2 A G 14: 60,617,269 (GRCm39) Y362C probably damaging Het
Amigo1 T C 3: 108,094,644 (GRCm39) S48P probably benign Het
Ano5 A G 7: 51,187,561 (GRCm39) K50R possibly damaging Het
Anxa2 A T 9: 69,391,098 (GRCm39) D95V probably damaging Het
Arhgap22 A G 14: 33,088,916 (GRCm39) N466D probably damaging Het
Armc3 T C 2: 19,297,953 (GRCm39) Y575H probably damaging Het
Ascc2 A G 11: 4,629,257 (GRCm39) E523G probably benign Het
B3galt5 A T 16: 96,117,225 (GRCm39) K286M probably damaging Het
Bag3 C T 7: 128,147,407 (GRCm39) H341Y probably benign Het
Blm G T 7: 80,155,697 (GRCm39) probably null Het
Cacna1b G A 2: 24,622,318 (GRCm39) P222L probably damaging Het
Cap2 T A 13: 46,791,357 (GRCm39) Y175N possibly damaging Het
Cd81 G T 7: 142,620,938 (GRCm39) G206* probably null Het
Cep290 T A 10: 100,367,046 (GRCm39) S1132R possibly damaging Het
Cluh C A 11: 74,550,355 (GRCm39) C222* probably null Het
Col14a1 A T 15: 55,313,336 (GRCm39) D1320V unknown Het
Col18a1 T C 10: 76,916,988 (GRCm39) I114V unknown Het
Cped1 A G 6: 22,233,926 (GRCm39) T847A probably damaging Het
Cpne7 A G 8: 123,854,176 (GRCm39) K288E possibly damaging Het
Cr2 G A 1: 194,836,458 (GRCm39) P1278S possibly damaging Het
Creb3 C A 4: 43,565,327 (GRCm39) R202S probably damaging Het
Cyp2j9 T A 4: 96,460,201 (GRCm39) K434M probably damaging Het
Dnai3 G T 3: 145,769,235 (GRCm39) T522K possibly damaging Het
Dpp10 A T 1: 123,832,833 (GRCm39) V48E probably null Het
Dsg2 A G 18: 20,734,530 (GRCm39) K836R probably damaging Het
Dst A G 1: 34,229,339 (GRCm39) T1986A probably benign Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Ecm2 A G 13: 49,683,732 (GRCm39) D570G probably benign Het
Efhc1 T A 1: 21,059,784 (GRCm39) C611* probably null Het
Epop T C 11: 97,519,480 (GRCm39) T210A probably benign Het
Erc2 A G 14: 27,733,593 (GRCm39) I556V probably benign Het
Fdxacb1 A T 9: 50,682,946 (GRCm39) N101I probably benign Het
Fhad1 T C 4: 141,709,473 (GRCm39) S294G possibly damaging Het
Galnt16 A G 12: 80,630,430 (GRCm39) D262G probably damaging Het
Gorab A G 1: 163,224,625 (GRCm39) S59P probably damaging Het
Gpr161 G T 1: 165,134,132 (GRCm39) M131I probably damaging Het
Gpr22 T A 12: 31,759,202 (GRCm39) M270L probably benign Het
Grin3b C A 10: 79,806,746 (GRCm39) Q5K probably benign Het
Grin3b C T 10: 79,810,480 (GRCm39) A662V probably damaging Het
Gsdmc A G 15: 63,673,748 (GRCm39) I179T probably benign Het
Gsdmc2 T A 15: 63,700,086 (GRCm39) M229L probably benign Het
H2-Eb2 A G 17: 34,553,278 (GRCm39) I155V probably benign Het
Hoga1 A C 19: 42,048,459 (GRCm39) probably null Het
Hs3st5 A G 10: 36,708,882 (GRCm39) Y139C probably damaging Het
Il10ra C A 9: 45,167,109 (GRCm39) A481S probably benign Het
Ints2 T A 11: 86,139,760 (GRCm39) H278L possibly damaging Het
Klhl25 T A 7: 75,516,480 (GRCm39) V157D probably damaging Het
Klk1b26 A T 7: 43,666,324 (GRCm39) T256S probably damaging Het
Krt81 T C 15: 101,360,435 (GRCm39) Q184R probably benign Het
Lce1k A T 3: 92,714,125 (GRCm39) C20S unknown Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lin54 A G 5: 100,633,660 (GRCm39) probably null Het
Lrrc37a T C 11: 103,391,087 (GRCm39) E1446G probably benign Het
Macf1 A G 4: 123,350,488 (GRCm39) S3792P probably damaging Het
Manba T A 3: 135,256,952 (GRCm39) D538E probably benign Het
Mcc C A 18: 44,624,382 (GRCm39) E213* probably null Het
Mfap4 T C 11: 61,376,633 (GRCm39) probably null Het
Muc21 A T 17: 35,929,600 (GRCm39) S1529T probably benign Het
Nebl T A 2: 17,457,321 (GRCm39) I80F probably damaging Het
Nek4 A G 14: 30,678,910 (GRCm39) I145V probably damaging Het
Nlrp14 T C 7: 106,795,407 (GRCm39) V230A probably benign Het
Nxf3 G A X: 134,976,583 (GRCm39) P380S possibly damaging Het
Or11h6 G A 14: 50,880,323 (GRCm39) C195Y possibly damaging Het
Or1a1 T C 11: 74,086,989 (GRCm39) V220A probably damaging Het
Or5b99 T C 19: 12,976,866 (GRCm39) V172A possibly damaging Het
Or5p66 C A 7: 107,885,566 (GRCm39) G256* probably null Het
Or6k8-ps1 C T 1: 173,979,687 (GRCm39) H202Y probably damaging Het
Pcdhb13 C T 18: 37,576,912 (GRCm39) T430I possibly damaging Het
Piezo2 A T 18: 63,207,733 (GRCm39) L1426Q probably null Het
Pigk T A 3: 152,450,131 (GRCm39) Y212N probably damaging Het
Pigm T G 1: 172,204,828 (GRCm39) L188R probably damaging Het
Plce1 T C 19: 38,766,368 (GRCm39) F2117S probably damaging Het
Plec A G 15: 76,057,743 (GRCm39) F4055L probably damaging Het
Plk5 C T 10: 80,198,936 (GRCm39) S435L possibly damaging Het
Pms1 G A 1: 53,321,201 (GRCm39) L11F probably damaging Het
Prl3b1 C T 13: 27,431,895 (GRCm39) T140I possibly damaging Het
Prl7a1 T G 13: 27,817,655 (GRCm39) D203A probably damaging Het
Psg17 A G 7: 18,548,577 (GRCm39) V398A probably benign Het
Pum1 T A 4: 130,445,529 (GRCm39) I166K possibly damaging Het
R3hdm1 T A 1: 128,096,753 (GRCm39) D108E probably damaging Het
Reln A T 5: 22,174,358 (GRCm39) D1948E possibly damaging Het
Rnf112 C T 11: 61,343,252 (GRCm39) R141Q probably damaging Het
Rnf145 T C 11: 44,452,293 (GRCm39) V424A possibly damaging Het
Serpina3m C A 12: 104,355,958 (GRCm39) Y208* probably null Het
Serpind1 T C 16: 17,160,808 (GRCm39) V446A probably benign Het
Shc3 T A 13: 51,596,872 (GRCm39) M384L probably benign Het
Slc38a11 A G 2: 65,160,683 (GRCm39) F304L probably benign Het
Slpi C T 2: 164,197,463 (GRCm39) C28Y probably damaging Het
Specc1 C A 11: 61,920,120 (GRCm39) P7T possibly damaging Het
Spib T C 7: 44,178,281 (GRCm39) E180G probably benign Het
Spint5 T C 2: 164,558,903 (GRCm39) probably benign Het
Ssr2 T A 3: 88,484,174 (GRCm39) probably benign Het
Tbrg1 T C 9: 37,560,715 (GRCm39) D387G probably benign Het
Tex14 T G 11: 87,440,296 (GRCm39) L1367R probably damaging Het
Tfpi A C 2: 84,288,360 (GRCm39) probably benign Het
Tlr5 T A 1: 182,801,912 (GRCm39) D405E probably damaging Het
Tnnt3 C T 7: 142,065,262 (GRCm39) R131C possibly damaging Het
Tnxb T C 17: 34,890,878 (GRCm39) V407A probably damaging Het
Tnxb A G 17: 34,901,225 (GRCm39) Y1013C probably damaging Het
Tpx2 T A 2: 152,732,544 (GRCm39) M606K probably benign Het
Trim30a T A 7: 104,079,437 (GRCm39) probably benign Het
Trim46 A T 3: 89,145,008 (GRCm39) Y489N probably damaging Het
Trpm6 A T 19: 18,773,648 (GRCm39) H380L probably benign Het
Tstd2 A G 4: 46,120,563 (GRCm39) I279T probably benign Het
Ttn C T 2: 76,776,735 (GRCm39) probably null Het
Txnl1 T C 18: 63,812,585 (GRCm39) T70A probably benign Het
Ush2a C T 1: 188,310,729 (GRCm39) probably benign Het
Usp1 A G 4: 98,822,531 (GRCm39) D615G probably benign Het
Virma T A 4: 11,519,242 (GRCm39) C830S probably benign Het
Vmn1r7 A T 6: 57,001,853 (GRCm39) S136T probably benign Het
Vmn2r9 A G 5: 108,994,305 (GRCm39) V448A probably damaging Het
Vps11 G A 9: 44,270,524 (GRCm39) H183Y probably damaging Het
Vsig10l A G 7: 43,116,892 (GRCm39) T476A possibly damaging Het
Whamm C T 7: 81,241,519 (GRCm39) R277* probably null Het
Wnt8a A G 18: 34,677,937 (GRCm39) D115G probably damaging Het
Xndc1 T A 7: 101,722,398 (GRCm39) V21E probably damaging Het
Zc3hav1 C A 6: 38,313,452 (GRCm39) V198L probably damaging Het
Zfp874a T A 13: 67,590,623 (GRCm39) I354F probably benign Het
Zfr2 A T 10: 81,078,686 (GRCm39) D306V possibly damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 33,996,092 (GRCm39) splice site probably benign
IGL01364:Kalrn APN 16 34,082,999 (GRCm39) missense probably damaging 1.00
IGL01510:Kalrn APN 16 34,055,700 (GRCm39) missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34,114,531 (GRCm39) missense probably damaging 1.00
IGL01934:Kalrn APN 16 34,018,882 (GRCm39) splice site probably null
IGL02059:Kalrn APN 16 34,072,711 (GRCm39) missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34,040,592 (GRCm39) missense probably damaging 1.00
IGL02306:Kalrn APN 16 34,130,897 (GRCm39) missense probably damaging 0.97
IGL02328:Kalrn APN 16 34,152,594 (GRCm39) missense probably damaging 0.98
IGL02532:Kalrn APN 16 34,181,216 (GRCm39) missense probably damaging 1.00
IGL02685:Kalrn APN 16 34,334,329 (GRCm39) nonsense probably null
IGL02696:Kalrn APN 16 34,040,484 (GRCm39) missense probably damaging 1.00
IGL02708:Kalrn APN 16 34,212,420 (GRCm39) missense probably damaging 1.00
IGL02937:Kalrn APN 16 34,040,500 (GRCm39) nonsense probably null
IGL03188:Kalrn APN 16 34,134,562 (GRCm39) missense probably benign 0.01
IGL03289:Kalrn APN 16 34,205,667 (GRCm39) missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34,134,546 (GRCm39) missense probably damaging 0.99
breeze UTSW 16 33,834,045 (GRCm39) missense
ethereal UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
Feather UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
Hidden UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
Soulful UTSW 16 34,007,854 (GRCm39) nonsense probably null
G1Funyon:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 33,851,952 (GRCm39) missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34,018,884 (GRCm39) splice site probably benign
R0043:Kalrn UTSW 16 33,875,276 (GRCm39) missense probably damaging 1.00
R0052:Kalrn UTSW 16 34,177,541 (GRCm39) missense probably damaging 1.00
R0066:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0111:Kalrn UTSW 16 33,851,960 (GRCm39) missense probably damaging 1.00
R0113:Kalrn UTSW 16 33,870,306 (GRCm39) intron probably benign
R0183:Kalrn UTSW 16 33,991,749 (GRCm39) splice site probably null
R0422:Kalrn UTSW 16 34,134,643 (GRCm39) missense probably damaging 0.99
R0498:Kalrn UTSW 16 33,875,261 (GRCm39) missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33,814,040 (GRCm39) splice site probably benign
R0656:Kalrn UTSW 16 33,852,837 (GRCm39) missense probably damaging 1.00
R0671:Kalrn UTSW 16 33,936,778 (GRCm39) missense probably benign 0.04
R0707:Kalrn UTSW 16 33,830,951 (GRCm39) missense possibly damaging 0.88
R0709:Kalrn UTSW 16 33,855,924 (GRCm39) missense probably damaging 1.00
R0834:Kalrn UTSW 16 33,870,289 (GRCm39) missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34,205,760 (GRCm39) missense probably damaging 1.00
R1297:Kalrn UTSW 16 33,836,868 (GRCm39) missense probably damaging 0.99
R1355:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33,809,173 (GRCm39) missense probably benign 0.01
R1398:Kalrn UTSW 16 34,033,190 (GRCm39) missense probably damaging 1.00
R1427:Kalrn UTSW 16 33,796,124 (GRCm39) missense probably damaging 1.00
R1458:Kalrn UTSW 16 33,994,857 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1557:Kalrn UTSW 16 34,134,648 (GRCm39) missense possibly damaging 0.92
R1559:Kalrn UTSW 16 33,830,918 (GRCm39) missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1703:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R1759:Kalrn UTSW 16 34,181,320 (GRCm39) missense probably damaging 0.97
R1764:Kalrn UTSW 16 34,033,243 (GRCm39) missense probably damaging 1.00
R1824:Kalrn UTSW 16 34,114,585 (GRCm39) missense probably damaging 1.00
R1845:Kalrn UTSW 16 34,177,331 (GRCm39) missense probably damaging 0.99
R1850:Kalrn UTSW 16 33,796,293 (GRCm39) missense probably damaging 0.98
R1921:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1922:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1970:Kalrn UTSW 16 33,797,894 (GRCm39) critical splice donor site probably null
R1992:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R2001:Kalrn UTSW 16 33,848,415 (GRCm39) missense probably damaging 1.00
R2025:Kalrn UTSW 16 34,010,106 (GRCm39) missense probably damaging 0.96
R2048:Kalrn UTSW 16 34,072,680 (GRCm39) missense probably benign 0.18
R2076:Kalrn UTSW 16 34,152,513 (GRCm39) missense probably benign 0.15
R2118:Kalrn UTSW 16 34,152,600 (GRCm39) missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34,128,094 (GRCm39) missense possibly damaging 0.82
R2145:Kalrn UTSW 16 33,829,632 (GRCm39) unclassified probably benign
R2193:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2234:Kalrn UTSW 16 33,996,632 (GRCm39) splice site probably null
R2404:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34,130,865 (GRCm39) missense probably damaging 1.00
R2903:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34,032,642 (GRCm39) missense probably benign 0.07
R3693:Kalrn UTSW 16 34,177,685 (GRCm39) missense probably damaging 1.00
R3709:Kalrn UTSW 16 34,212,400 (GRCm39) splice site probably null
R3788:Kalrn UTSW 16 34,040,610 (GRCm39) missense probably damaging 1.00
R3833:Kalrn UTSW 16 33,860,259 (GRCm39) nonsense probably null
R3871:Kalrn UTSW 16 34,024,226 (GRCm39) splice site probably null
R3934:Kalrn UTSW 16 34,130,901 (GRCm39) missense probably benign 0.34
R4033:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4057:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4303:Kalrn UTSW 16 34,055,761 (GRCm39) missense probably damaging 1.00
R4402:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33,807,578 (GRCm39) missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34,212,412 (GRCm39) missense probably damaging 0.98
R4583:Kalrn UTSW 16 34,055,637 (GRCm39) missense probably damaging 1.00
R4604:Kalrn UTSW 16 34,334,296 (GRCm39) missense possibly damaging 0.46
R4620:Kalrn UTSW 16 33,849,075 (GRCm39) missense probably damaging 0.99
R4651:Kalrn UTSW 16 33,996,761 (GRCm39) missense probably damaging 1.00
R4703:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4704:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4705:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4760:Kalrn UTSW 16 34,018,857 (GRCm39) missense probably damaging 1.00
R4793:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34,177,339 (GRCm39) missense probably damaging 1.00
R4816:Kalrn UTSW 16 34,334,389 (GRCm39) unclassified probably benign
R4888:Kalrn UTSW 16 33,991,700 (GRCm39) missense probably damaging 1.00
R4952:Kalrn UTSW 16 34,177,785 (GRCm39) splice site probably null
R5030:Kalrn UTSW 16 33,796,112 (GRCm39) missense probably benign 0.00
R5045:Kalrn UTSW 16 34,134,722 (GRCm39) nonsense probably null
R5117:Kalrn UTSW 16 33,853,971 (GRCm39) critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34,072,711 (GRCm39) missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34,083,023 (GRCm39) missense probably damaging 1.00
R5432:Kalrn UTSW 16 33,873,992 (GRCm39) missense probably damaging 1.00
R5611:Kalrn UTSW 16 33,996,150 (GRCm39) missense probably damaging 1.00
R5629:Kalrn UTSW 16 33,860,304 (GRCm39) missense possibly damaging 0.77
R5635:Kalrn UTSW 16 33,834,454 (GRCm39) missense probably damaging 1.00
R5713:Kalrn UTSW 16 33,836,949 (GRCm39) missense probably benign
R5716:Kalrn UTSW 16 33,807,546 (GRCm39) missense probably benign 0.01
R5772:Kalrn UTSW 16 33,796,190 (GRCm39) missense probably damaging 1.00
R5797:Kalrn UTSW 16 34,032,619 (GRCm39) missense probably damaging 0.98
R5835:Kalrn UTSW 16 33,807,461 (GRCm39) missense probably benign 0.28
R5895:Kalrn UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
R5924:Kalrn UTSW 16 34,064,203 (GRCm39) missense probably damaging 1.00
R5999:Kalrn UTSW 16 34,177,713 (GRCm39) missense probably damaging 1.00
R6010:Kalrn UTSW 16 33,830,950 (GRCm39) missense probably benign 0.06
R6052:Kalrn UTSW 16 34,181,255 (GRCm39) missense probably damaging 1.00
R6122:Kalrn UTSW 16 33,805,561 (GRCm39) missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34,033,255 (GRCm39) missense probably damaging 0.99
R6136:Kalrn UTSW 16 34,177,481 (GRCm39) missense probably damaging 1.00
R6178:Kalrn UTSW 16 33,874,009 (GRCm39) missense possibly damaging 0.88
R6229:Kalrn UTSW 16 33,875,441 (GRCm39) missense probably damaging 1.00
R6376:Kalrn UTSW 16 33,796,361 (GRCm39) missense probably benign
R6397:Kalrn UTSW 16 33,813,355 (GRCm39) missense probably damaging 1.00
R6429:Kalrn UTSW 16 34,152,534 (GRCm39) missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34,025,672 (GRCm39) missense probably damaging 1.00
R6481:Kalrn UTSW 16 34,181,354 (GRCm39) missense probably damaging 1.00
R6597:Kalrn UTSW 16 34,003,117 (GRCm39) missense probably damaging 1.00
R6736:Kalrn UTSW 16 34,038,293 (GRCm39) missense probably damaging 1.00
R6808:Kalrn UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
R6897:Kalrn UTSW 16 33,796,073 (GRCm39) missense probably damaging 0.99
R6955:Kalrn UTSW 16 34,040,506 (GRCm39) missense probably damaging 1.00
R7060:Kalrn UTSW 16 34,177,418 (GRCm39) missense probably damaging 0.99
R7064:Kalrn UTSW 16 34,038,261 (GRCm39) missense probably damaging 1.00
R7132:Kalrn UTSW 16 34,076,597 (GRCm39) missense unknown
R7154:Kalrn UTSW 16 34,032,527 (GRCm39) critical splice donor site probably null
R7181:Kalrn UTSW 16 33,983,447 (GRCm39) missense probably benign 0.00
R7234:Kalrn UTSW 16 33,996,792 (GRCm39) missense possibly damaging 0.63
R7235:Kalrn UTSW 16 33,996,131 (GRCm39) missense probably benign 0.18
R7504:Kalrn UTSW 16 34,076,603 (GRCm39) missense unknown
R7563:Kalrn UTSW 16 34,212,464 (GRCm39) missense probably damaging 0.97
R7612:Kalrn UTSW 16 34,134,582 (GRCm39) missense possibly damaging 0.68
R7772:Kalrn UTSW 16 33,851,952 (GRCm39) missense probably benign 0.04
R7796:Kalrn UTSW 16 34,007,854 (GRCm39) nonsense probably null
R7867:Kalrn UTSW 16 33,810,161 (GRCm39) missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33,809,217 (GRCm39) missense probably damaging 0.98
R7914:Kalrn UTSW 16 33,849,122 (GRCm39) missense probably benign
R8080:Kalrn UTSW 16 33,796,038 (GRCm39) missense possibly damaging 0.83
R8147:Kalrn UTSW 16 33,875,414 (GRCm39) missense probably benign
R8239:Kalrn UTSW 16 33,870,153 (GRCm39) missense noncoding transcript
R8281:Kalrn UTSW 16 33,855,431 (GRCm39) nonsense probably null
R8294:Kalrn UTSW 16 33,853,954 (GRCm39) missense probably benign 0.12
R8301:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
R8686:Kalrn UTSW 16 34,181,305 (GRCm39) missense probably damaging 1.00
R8693:Kalrn UTSW 16 33,854,884 (GRCm39) missense probably damaging 1.00
R8798:Kalrn UTSW 16 33,803,225 (GRCm39) missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R8878:Kalrn UTSW 16 34,018,830 (GRCm39) missense probably benign 0.05
R8880:Kalrn UTSW 16 34,038,305 (GRCm39) missense probably damaging 1.00
R8883:Kalrn UTSW 16 33,814,025 (GRCm39) missense probably damaging 1.00
R8887:Kalrn UTSW 16 34,047,496 (GRCm39) missense probably benign 0.22
R9048:Kalrn UTSW 16 33,854,854 (GRCm39) missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34,181,371 (GRCm39) missense probably damaging 0.96
R9317:Kalrn UTSW 16 33,834,045 (GRCm39) missense
R9424:Kalrn UTSW 16 33,809,188 (GRCm39) missense probably benign 0.06
R9442:Kalrn UTSW 16 33,916,249 (GRCm39) start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33,805,600 (GRCm39) missense probably benign 0.13
R9515:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9516:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9625:Kalrn UTSW 16 33,849,197 (GRCm39) critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34,032,583 (GRCm39) missense probably benign 0.01
RF014:Kalrn UTSW 16 33,860,303 (GRCm39) missense probably benign 0.01
Z1177:Kalrn UTSW 16 33,855,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCACCCTATTGACGATGTAAC -3'
(R):5'- TGATCCAAGGCATCCCTGTC -3'

Sequencing Primer
(F):5'- ACGATGTAACTCTTGACATTGGG -3'
(R):5'- TGTCTCCCTGGGCACAG -3'
Posted On 2014-08-25