Mutagenetix > Incidental Mutation

Incidental Mutation 'R1991:Piezo2'

225276

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

040002-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1991 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63074662 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1426 (L1426Q)

Ref Sequence

ENSEMBL: ENSMUSP00000138758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000047480
AA Change: L1440Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: L1440Q

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182233

SMART Domains

Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	34	56	N/A	INTRINSIC
coiled coil region	223	250	N/A	INTRINSIC
transmembrane domain	272	294	N/A	INTRINSIC
transmembrane domain	307	329	N/A	INTRINSIC
SCOP:d1eq1a_	365	434	1e-3	SMART
transmembrane domain	450	472	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	540	552	N/A	INTRINSIC
transmembrane domain	559	581	N/A	INTRINSIC
low complexity region	668	689	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	744	761	N/A	INTRINSIC
transmembrane domain	768	790	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC
transmembrane domain	924	941	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000183217
AA Change: L1426Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: L1426Q

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Meta Mutation Damage Score

0.3986

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (124/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,065,658	R203*	probably null	Het
Abcc2	A	T	19: 43,807,142	I446F	probably damaging	Het
Afap1l2	A	T	19: 57,002,267	I18N	possibly damaging	Het
Aida	A	T	1: 183,313,692	E107D	probably benign	Het
Amer2	A	G	14: 60,379,820	Y362C	probably damaging	Het
Amigo1	T	C	3: 108,187,328	S48P	probably benign	Het
Ano5	A	G	7: 51,537,813	K50R	possibly damaging	Het
Anxa2	A	T	9: 69,483,816	D95V	probably damaging	Het
Arhgap22	A	G	14: 33,366,959	N466D	probably damaging	Het
Armc3	T	C	2: 19,293,142	Y575H	probably damaging	Het
Ascc2	A	G	11: 4,679,257	E523G	probably benign	Het
B3galt5	A	T	16: 96,316,025	K286M	probably damaging	Het
Bag3	C	T	7: 128,545,683	H341Y	probably benign	Het
Blm	G	T	7: 80,505,949		probably null	Het
Cacna1b	G	A	2: 24,732,306	P222L	probably damaging	Het
Cap2	T	A	13: 46,637,881	Y175N	possibly damaging	Het
Cd81	G	T	7: 143,067,201	G206*	probably null	Het
Cep290	T	A	10: 100,531,184	S1132R	possibly damaging	Het
Cluh	C	A	11: 74,659,529	C222*	probably null	Het
Col14a1	A	T	15: 55,449,940	D1320V	unknown	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Cped1	A	G	6: 22,233,927	T847A	probably damaging	Het
Cpne7	A	G	8: 123,127,437	K288E	possibly damaging	Het
Cr2	G	A	1: 195,154,150	P1278S	possibly damaging	Het
Creb3	C	A	4: 43,565,327	R202S	probably damaging	Het
Cyp2j9	T	A	4: 96,571,964	K434M	probably damaging	Het
Dpp10	A	T	1: 123,905,106	V48E	probably null	Het
Dsg2	A	G	18: 20,601,473	K836R	probably damaging	Het
Dst	A	G	1: 34,190,258	T1986A	probably benign	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Ecm2	A	G	13: 49,530,256	D570G	probably benign	Het
Efhc1	T	A	1: 20,989,560	C611*	probably null	Het
Epop	T	C	11: 97,628,654	T210A	probably benign	Het
Erc2	A	G	14: 28,011,636	I556V	probably benign	Het
Fdxacb1	A	T	9: 50,771,646	N101I	probably benign	Het
Fhad1	T	C	4: 141,982,162	S294G	possibly damaging	Het
Galnt16	A	G	12: 80,583,656	D262G	probably damaging	Het
Gm9573	A	T	17: 35,618,708	S1529T	probably benign	Het
Gorab	A	G	1: 163,397,056	S59P	probably damaging	Het
Gpr161	G	T	1: 165,306,563	M131I	probably damaging	Het
Gpr22	T	A	12: 31,709,203	M270L	probably benign	Het
Grin3b	C	A	10: 79,970,912	Q5K	probably benign	Het
Grin3b	C	T	10: 79,974,646	A662V	probably damaging	Het
Gsdmc	A	G	15: 63,801,899	I179T	probably benign	Het
Gsdmc2	T	A	15: 63,828,237	M229L	probably benign	Het
H2-Eb2	A	G	17: 34,334,304	I155V	probably benign	Het
Hoga1	A	C	19: 42,060,020		probably null	Het
Hs3st5	A	G	10: 36,832,886	Y139C	probably damaging	Het
Il10ra	C	A	9: 45,255,811	A481S	probably benign	Het
Ints2	T	A	11: 86,248,934	H278L	possibly damaging	Het
Kalrn	T	G	16: 33,975,738	L1222F	probably damaging	Het
Klhl25	T	A	7: 75,866,732	V157D	probably damaging	Het
Klk1b26	A	T	7: 44,016,900	T256S	probably damaging	Het
Krt81	T	C	15: 101,462,554	Q184R	probably benign	Het
Lce1k	A	T	3: 92,806,818	C20S	unknown	Het
Letm1	A	AG	5: 33,769,515		probably null	Het
Lin54	A	G	5: 100,485,801		probably null	Het
Lrrc37a	T	C	11: 103,500,261	E1446G	probably benign	Het
Macf1	A	G	4: 123,456,695	S3792P	probably damaging	Het
Manba	T	A	3: 135,551,191	D538E	probably benign	Het
Mcc	C	A	18: 44,491,315	E213*	probably null	Het
Mfap4	T	C	11: 61,485,807		probably null	Het
Nebl	T	A	2: 17,452,510	I80F	probably damaging	Het
Nek4	A	G	14: 30,956,953	I145V	probably damaging	Het
Nlrp14	T	C	7: 107,196,200	V230A	probably benign	Het
Nxf3	G	A	X: 136,075,834	P380S	possibly damaging	Het
Olfr1451	T	C	19: 12,999,502	V172A	possibly damaging	Het
Olfr403	T	C	11: 74,196,163	V220A	probably damaging	Het
Olfr421-ps1	C	T	1: 174,152,121	H202Y	probably damaging	Het
Olfr490	C	A	7: 108,286,359	G256*	probably null	Het
Olfr745	G	A	14: 50,642,866	C195Y	possibly damaging	Het
Pcdhb13	C	T	18: 37,443,859	T430I	possibly damaging	Het
Pigk	T	A	3: 152,744,494	Y212N	probably damaging	Het
Pigm	T	G	1: 172,377,261	L188R	probably damaging	Het
Plce1	T	C	19: 38,777,924	F2117S	probably damaging	Het
Plec	A	G	15: 76,173,543	F4055L	probably damaging	Het
Plk5	C	T	10: 80,363,102	S435L	possibly damaging	Het
Pms1	G	A	1: 53,282,042	L11F	probably damaging	Het
Prl3b1	C	T	13: 27,247,912	T140I	possibly damaging	Het
Prl7a1	T	G	13: 27,633,672	D203A	probably damaging	Het
Psg17	A	G	7: 18,814,652	V398A	probably benign	Het
Pum1	T	A	4: 130,718,218	I166K	possibly damaging	Het
R3hdm1	T	A	1: 128,169,016	D108E	probably damaging	Het
Reln	A	T	5: 21,969,360	D1948E	possibly damaging	Het
Rnf112	C	T	11: 61,452,426	R141Q	probably damaging	Het
Rnf145	T	C	11: 44,561,466	V424A	possibly damaging	Het
Serpina3m	C	A	12: 104,389,699	Y208*	probably null	Het
Serpind1	T	C	16: 17,342,944	V446A	probably benign	Het
Shc3	T	A	13: 51,442,836	M384L	probably benign	Het
Slc38a11	A	G	2: 65,330,339	F304L	probably benign	Het
Slpi	C	T	2: 164,355,543	C28Y	probably damaging	Het
Specc1	C	A	11: 62,029,294	P7T	possibly damaging	Het
Spib	T	C	7: 44,528,857	E180G	probably benign	Het
Spint5	T	C	2: 164,716,983		probably benign	Het
Ssr2	T	A	3: 88,576,867		probably benign	Het
Tbrg1	T	C	9: 37,649,419	D387G	probably benign	Het
Tex14	T	G	11: 87,549,470	L1367R	probably damaging	Het
Tfpi	A	C	2: 84,458,016		probably benign	Het
Tlr5	T	A	1: 182,974,347	D405E	probably damaging	Het
Tnnt3	C	T	7: 142,511,525	R131C	possibly damaging	Het
Tnxb	T	C	17: 34,671,904	V407A	probably damaging	Het
Tnxb	A	G	17: 34,682,251	Y1013C	probably damaging	Het
Tpx2	T	A	2: 152,890,624	M606K	probably benign	Het
Trim30a	T	A	7: 104,430,230		probably benign	Het
Trim46	A	T	3: 89,237,701	Y489N	probably damaging	Het
Trpm6	A	T	19: 18,796,284	H380L	probably benign	Het
Tstd2	A	G	4: 46,120,563	I279T	probably benign	Het
Ttn	C	T	2: 76,946,391		probably null	Het
Txnl1	T	C	18: 63,679,514	T70A	probably benign	Het
Ush2a	C	T	1: 188,578,532		probably benign	Het
Usp1	A	G	4: 98,934,294	D615G	probably benign	Het
Virma	T	A	4: 11,519,242	C830S	probably benign	Het
Vmn1r7	A	T	6: 57,024,868	S136T	probably benign	Het
Vmn2r9	A	G	5: 108,846,439	V448A	probably damaging	Het
Vps11	G	A	9: 44,359,227	H183Y	probably damaging	Het
Vsig10l	A	G	7: 43,467,468	T476A	possibly damaging	Het
Wdr63	G	T	3: 146,063,480	T522K	possibly damaging	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt8a	A	G	18: 34,544,884	D115G	probably damaging	Het
Xndc1	T	A	7: 102,073,191	V21E	probably damaging	Het
Zc3hav1	C	A	6: 38,336,517	V198L	probably damaging	Het
Zfp874a	T	A	13: 67,442,504	I354F	probably benign	Het
Zfr2	A	T	10: 81,242,852	D306V	possibly damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1868:Piezo2	UTSW	18	63019344	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63386276	start gained	probably benign
R9608:Piezo2	UTSW	18	63146945	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63115037	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63064696	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTGGTGTCCAGTCCTTTAGG -3'
(R):5'- TCCCAAGCCTGGTTCTGTAG -3'

Sequencing Primer
(F):5'- TGTGTGTGTGTGAGAGAGAGAGAG -3'
(R):5'- CTGTAGACTTTATACAACCGGGAG -3'

Posted On

2014-08-25