Incidental Mutation 'R2038:Sfpq'
ID225285
Institutional Source Beutler Lab
Gene Symbol Sfpq
Ensembl Gene ENSMUSG00000028820
Gene Namesplicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms2810416M14Rik, PSF, 1110004P21Rik, 5730453G22Rik, REP1, D4Ertd314e, 9030402K04Rik
MMRRC Submission 040045-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2038 (G1)
Quality Score122
Status Not validated
Chromosome4
Chromosomal Location127021324-127037013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127021502 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 29 (H29L)
Ref Sequence ENSEMBL: ENSMUSP00000030623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030623]
Predicted Effect unknown
Transcript: ENSMUST00000030623
AA Change: H29L
SMART Domains Protein: ENSMUSP00000030623
Gene: ENSMUSG00000028820
AA Change: H29L

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 48 101 N/A INTRINSIC
low complexity region 105 236 N/A INTRINSIC
low complexity region 238 258 N/A INTRINSIC
RRM 290 357 3.97e-18 SMART
RRM 364 440 3.83e-11 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 554 587 N/A INTRINSIC
low complexity region 595 614 N/A INTRINSIC
low complexity region 617 639 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 682 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146285
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele die. Heterozygous mice show abnormality in entrainment of circadian rhythm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,663,023 Y54C probably damaging Het
9030624J02Rik T C 7: 118,811,874 F677L probably damaging Het
Adgrf4 A T 17: 42,667,863 H196Q probably damaging Het
Astn1 T G 1: 158,657,120 S918A probably benign Het
Cd79a A T 7: 24,899,357 K110N probably benign Het
Cdc34b C T 11: 94,742,288 Q105* probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Clpx G A 9: 65,317,493 G168R probably damaging Het
Col8a2 T C 4: 126,311,315 probably benign Het
Ddx27 G A 2: 167,033,755 E669K probably damaging Het
Dnah8 A T 17: 30,758,281 I2898F probably damaging Het
Dus2 T C 8: 106,048,662 Y274H probably damaging Het
Dync2h1 A G 9: 6,967,226 S4073P probably damaging Het
Dynlrb2 G A 8: 116,514,810 R31Q possibly damaging Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Fhdc1 A T 3: 84,444,561 L1119Q probably benign Het
H2-T10 T C 17: 36,119,425 K212E probably benign Het
H60b A T 10: 22,286,215 N113I probably benign Het
Hace1 A C 10: 45,700,625 K798Q probably benign Het
Hdac7 C T 15: 97,798,270 R631H probably damaging Het
Kat7 T A 11: 95,300,102 I153F probably benign Het
Lman1 T C 18: 65,998,610 T101A probably benign Het
Mapk8 A T 14: 33,388,936 C245* probably null Het
Mfhas1 T A 8: 35,591,277 W969R probably damaging Het
Mlxipl A T 5: 135,106,999 D26V probably damaging Het
Msh5 A G 17: 35,046,040 V53A probably benign Het
Msl2 C A 9: 101,101,984 A519D probably damaging Het
Nbeal1 A G 1: 60,206,344 S176G probably benign Het
Ninl T A 2: 150,975,843 K134* probably null Het
Olfr1240 C A 2: 89,439,345 M311I probably benign Het
Olfr384 T A 11: 73,603,413 Y278N probably damaging Het
Olfr959 A G 9: 39,572,987 S91P probably damaging Het
Pabpn1 T G 14: 54,897,152 I250S probably damaging Het
Ppp4r4 G A 12: 103,576,280 probably null Het
Rad51ap2 T C 12: 11,457,024 S316P possibly damaging Het
Scn7a C A 2: 66,737,436 W271C probably damaging Het
Set T C 2: 30,070,200 S182P probably benign Het
Sez6l T C 5: 112,472,752 T321A possibly damaging Het
Slc33a1 A G 3: 63,948,156 L356P probably damaging Het
Sptbn1 C G 11: 30,159,293 probably null Het
Srrd C T 5: 112,338,450 G179D probably benign Het
Taf4b T C 18: 14,807,399 S312P probably damaging Het
Tgfbrap1 A T 1: 43,054,634 L566* probably null Het
Tln2 T A 9: 67,397,653 M1L probably benign Het
Ttc27 T C 17: 74,856,502 F702L probably benign Het
Vmn2r54 C T 7: 12,629,710 G419R possibly damaging Het
Vps13b A G 15: 35,884,741 S3187G probably damaging Het
Vps13d C A 4: 145,181,115 probably null Het
Zfp568 A T 7: 29,989,082 E23V probably null Het
Other mutations in Sfpq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Sfpq APN 4 127023688 missense possibly damaging 0.80
IGL00578:Sfpq APN 4 127025907 missense probably damaging 1.00
IGL01301:Sfpq APN 4 127026760 splice site probably benign
IGL02385:Sfpq APN 4 127026136 splice site probably null
IGL03373:Sfpq APN 4 127026785 missense possibly damaging 0.92
R0645:Sfpq UTSW 4 127022969 missense possibly damaging 0.75
R3120:Sfpq UTSW 4 127022133 missense unknown
R4609:Sfpq UTSW 4 127021611 missense unknown
R4788:Sfpq UTSW 4 127025998 missense probably damaging 1.00
R5034:Sfpq UTSW 4 127023669 splice site probably benign
R5411:Sfpq UTSW 4 127021723 missense unknown
R6115:Sfpq UTSW 4 127021348 start gained probably null
R6906:Sfpq UTSW 4 127021626 small deletion probably benign
R6907:Sfpq UTSW 4 127021626 small deletion probably benign
R6908:Sfpq UTSW 4 127021626 small deletion probably benign
R6929:Sfpq UTSW 4 127021626 small deletion probably benign
R6933:Sfpq UTSW 4 127021626 small deletion probably benign
R7029:Sfpq UTSW 4 127029882 missense probably benign 0.23
R7124:Sfpq UTSW 4 127025932 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CATTTTGTGCTCAGCAAGGT -3'
(R):5'- GCATCTTGCCGCCTTTTGGA -3'

Sequencing Primer
(F):5'- TGCTCAGCAAGGTGGCAAC -3'
(R):5'- ACGACGGGCTTGGATTCCTG -3'
Posted On2014-08-25