Incidental Mutation 'R2005:Adgrb3'
ID 225294
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Name adhesion G protein-coupled receptor B3
Synonyms Bai3, A830096D10Rik
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.409) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 25106557-25868788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25150799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1145 (M1145V)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
AlphaFold Q80ZF8
Predicted Effect probably benign
Transcript: ENSMUST00000041838
AA Change: M1145V

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: M1145V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126096
Predicted Effect probably benign
Transcript: ENSMUST00000126626
AA Change: M275V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: M275V

DomainStartEndE-ValueType
Pfam:7tm_2 4 273 7.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135518
AA Change: M1145V

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: M1145V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146592
AA Change: M905V

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: M905V

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151309
AA Change: M1145V

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: M1145V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153568
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25,267,581 (GRCm39) missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25,113,796 (GRCm39) missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25,527,200 (GRCm39) missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25,132,868 (GRCm39) missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25,151,352 (GRCm39) missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25,151,252 (GRCm39) splice site probably null
IGL01608:Adgrb3 APN 1 25,592,855 (GRCm39) missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25,598,832 (GRCm39) splice site probably benign
IGL01657:Adgrb3 APN 1 25,865,574 (GRCm39) missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25,499,832 (GRCm39) missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25,865,360 (GRCm39) missense probably benign
IGL01767:Adgrb3 APN 1 25,598,895 (GRCm39) missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25,140,512 (GRCm39) critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25,459,631 (GRCm39) splice site probably benign
IGL02584:Adgrb3 APN 1 25,544,065 (GRCm39) missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25,123,323 (GRCm39) critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25,543,991 (GRCm39) splice site probably null
IGL02929:Adgrb3 APN 1 25,592,905 (GRCm39) missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25,570,978 (GRCm39) nonsense probably null
IGL03165:Adgrb3 APN 1 25,133,475 (GRCm39) missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25,586,556 (GRCm39) missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25,543,529 (GRCm39) missense probably damaging 0.99
schwach UTSW 1 25,150,772 (GRCm39) critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25,150,772 (GRCm39) critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25,140,563 (GRCm39) missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25,140,563 (GRCm39) missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25,260,829 (GRCm39) splice site probably benign
R0442:Adgrb3 UTSW 1 25,435,551 (GRCm39) missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25,586,635 (GRCm39) missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25,865,280 (GRCm39) missense probably benign
R1252:Adgrb3 UTSW 1 25,167,909 (GRCm39) missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25,598,931 (GRCm39) missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25,527,169 (GRCm39) missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25,133,264 (GRCm39) missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25,133,153 (GRCm39) missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25,265,912 (GRCm39) splice site probably null
R1653:Adgrb3 UTSW 1 25,140,584 (GRCm39) missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25,865,381 (GRCm39) missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25,267,552 (GRCm39) missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25,571,658 (GRCm39) missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25,123,351 (GRCm39) missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25,865,519 (GRCm39) missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25,586,525 (GRCm39) missense probably benign 0.02
R2134:Adgrb3 UTSW 1 25,133,038 (GRCm39) missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25,107,290 (GRCm39) missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25,150,898 (GRCm39) missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25,865,535 (GRCm39) missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25,150,906 (GRCm39) missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25,133,388 (GRCm39) nonsense probably null
R4344:Adgrb3 UTSW 1 25,865,829 (GRCm39) missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25,151,303 (GRCm39) missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25,870,108 (GRCm39) unclassified probably benign
R4465:Adgrb3 UTSW 1 25,133,447 (GRCm39) missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25,150,829 (GRCm39) missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25,123,360 (GRCm39) missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25,123,360 (GRCm39) missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25,865,569 (GRCm39) missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25,586,613 (GRCm39) missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25,570,956 (GRCm39) missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25,260,908 (GRCm39) missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25,113,860 (GRCm39) missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25,107,209 (GRCm39) utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25,865,165 (GRCm39) missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25,133,033 (GRCm39) missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25,150,871 (GRCm39) missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25,133,356 (GRCm39) missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25,167,940 (GRCm39) missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25,459,640 (GRCm39) missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25,865,643 (GRCm39) missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25,470,582 (GRCm39) splice site probably null
R6006:Adgrb3 UTSW 1 25,865,612 (GRCm39) missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25,133,081 (GRCm39) nonsense probably null
R6183:Adgrb3 UTSW 1 25,133,451 (GRCm39) missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25,459,728 (GRCm39) missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25,471,639 (GRCm39) missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25,150,799 (GRCm39) missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25,459,683 (GRCm39) missense probably benign
R6678:Adgrb3 UTSW 1 25,499,891 (GRCm39) missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25,170,377 (GRCm39) missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25,150,817 (GRCm39) nonsense probably null
R6730:Adgrb3 UTSW 1 25,133,375 (GRCm39) missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25,865,253 (GRCm39) missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25,133,003 (GRCm39) missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25,150,852 (GRCm39) nonsense probably null
R6953:Adgrb3 UTSW 1 25,865,592 (GRCm39) missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25,865,166 (GRCm39) missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25,170,350 (GRCm39) missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25,570,957 (GRCm39) missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25,571,711 (GRCm39) missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25,571,000 (GRCm39) nonsense probably null
R7489:Adgrb3 UTSW 1 25,586,586 (GRCm39) missense probably damaging 1.00
R7615:Adgrb3 UTSW 1 25,137,978 (GRCm39) missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25,586,629 (GRCm39) missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25,471,625 (GRCm39) missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25,167,915 (GRCm39) missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25,459,637 (GRCm39) critical splice donor site probably null
R8152:Adgrb3 UTSW 1 25,260,838 (GRCm39) splice site probably null
R8161:Adgrb3 UTSW 1 25,133,003 (GRCm39) missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25,865,597 (GRCm39) missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25,527,134 (GRCm39) missense probably benign 0.21
R8694:Adgrb3 UTSW 1 25,865,472 (GRCm39) missense probably damaging 0.98
R8742:Adgrb3 UTSW 1 25,265,835 (GRCm39) missense probably benign 0.01
R8886:Adgrb3 UTSW 1 25,150,928 (GRCm39) missense probably damaging 1.00
R8941:Adgrb3 UTSW 1 25,133,235 (GRCm39) missense probably damaging 1.00
R8958:Adgrb3 UTSW 1 25,865,190 (GRCm39) missense possibly damaging 0.68
R8979:Adgrb3 UTSW 1 25,527,115 (GRCm39) missense probably benign 0.03
R9064:Adgrb3 UTSW 1 25,570,965 (GRCm39) missense possibly damaging 0.86
R9252:Adgrb3 UTSW 1 25,865,496 (GRCm39) missense probably benign 0.03
R9401:Adgrb3 UTSW 1 25,592,783 (GRCm39) missense probably damaging 1.00
R9739:Adgrb3 UTSW 1 25,592,849 (GRCm39) missense probably damaging 1.00
Z1088:Adgrb3 UTSW 1 25,170,352 (GRCm39) missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25,132,995 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTACTGAGTGTCGAAGCCTC -3'
(R):5'- GCAACTACATCATGTCGCTTTC -3'

Sequencing Primer
(F):5'- GTCGAAGCCTCATGAATTTTGC -3'
(R):5'- AACTACATCATGTCGCTTTCTTTTC -3'
Posted On 2014-08-25