Incidental Mutation 'R2005:Kcnt2'
ID 225310
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Name potassium channel, subfamily T, member 2
Synonyms E330038N15Rik
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 140173896-140539805 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140480756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 824 (M824V)
Ref Sequence ENSEMBL: ENSMUSP00000112887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
AlphaFold D3Z649
Predicted Effect possibly damaging
Transcript: ENSMUST00000060201
AA Change: M855V

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054623
Gene: ENSMUSG00000052726
AA Change: M855V

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 424 533 1.3e-31 PFAM
low complexity region 655 670 N/A INTRINSIC
low complexity region 677 689 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119786
AA Change: M774V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: M774V

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120709
AA Change: M824V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: M824V

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120796
AA Change: M848V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: M848V

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193606
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140,450,836 (GRCm39) missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140,523,789 (GRCm39) missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140,450,949 (GRCm39) missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140,282,293 (GRCm39) critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140,498,155 (GRCm39) missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140,523,736 (GRCm39) missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140,304,121 (GRCm39) missense probably benign
IGL02350:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02483:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02866:Kcnt2 APN 1 140,352,986 (GRCm39) missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140,502,544 (GRCm39) missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140,282,245 (GRCm39) missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140,498,193 (GRCm39) missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140,461,740 (GRCm39) intron probably benign
BB002:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
BB012:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R0230:Kcnt2 UTSW 1 140,174,083 (GRCm39) missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140,278,963 (GRCm39) missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140,437,218 (GRCm39) nonsense probably null
R0543:Kcnt2 UTSW 1 140,537,352 (GRCm39) missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140,435,500 (GRCm39) missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140,501,346 (GRCm39) missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140,356,593 (GRCm39) missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140,310,766 (GRCm39) missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140,411,970 (GRCm39) nonsense probably null
R1546:Kcnt2 UTSW 1 140,359,116 (GRCm39) missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140,353,068 (GRCm39) missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140,511,985 (GRCm39) missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140,512,031 (GRCm39) missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140,353,079 (GRCm39) missense probably damaging 1.00
R2044:Kcnt2 UTSW 1 140,302,892 (GRCm39) missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140,480,701 (GRCm39) missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140,356,551 (GRCm39) missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140,437,179 (GRCm39) missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140,458,538 (GRCm39) missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140,501,421 (GRCm39) splice site probably null
R2442:Kcnt2 UTSW 1 140,304,091 (GRCm39) missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140,356,622 (GRCm39) missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140,461,706 (GRCm39) missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140,512,025 (GRCm39) missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140,537,368 (GRCm39) missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140,353,070 (GRCm39) missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140,480,718 (GRCm39) missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140,435,485 (GRCm39) missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140,450,886 (GRCm39) missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140,446,635 (GRCm39) missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140,282,254 (GRCm39) missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140,440,763 (GRCm39) nonsense probably null
R4973:Kcnt2 UTSW 1 140,537,388 (GRCm39) missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140,278,994 (GRCm39) missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140,537,353 (GRCm39) missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140,354,639 (GRCm39) missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140,502,481 (GRCm39) missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140,437,234 (GRCm39) missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140,353,104 (GRCm39) missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140,461,666 (GRCm39) missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140,435,440 (GRCm39) missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140,290,718 (GRCm39) missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140,354,661 (GRCm39) nonsense probably null
R6248:Kcnt2 UTSW 1 140,437,216 (GRCm39) missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140,302,850 (GRCm39) missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140,437,322 (GRCm39) missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140,511,844 (GRCm39) missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140,278,965 (GRCm39) missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140,173,931 (GRCm39) unclassified probably benign
R6856:Kcnt2 UTSW 1 140,523,742 (GRCm39) missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140,511,803 (GRCm39) missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140,440,646 (GRCm39) missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140,310,785 (GRCm39) missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140,523,778 (GRCm39) missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140,282,255 (GRCm39) missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140,498,216 (GRCm39) missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140,511,793 (GRCm39) missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140,304,122 (GRCm39) missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140,450,928 (GRCm39) missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140,498,199 (GRCm39) missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140,446,686 (GRCm39) missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140,501,385 (GRCm39) missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140,450,888 (GRCm39) missense probably damaging 0.99
R7925:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R8040:Kcnt2 UTSW 1 140,377,955 (GRCm39) missense probably damaging 1.00
R8041:Kcnt2 UTSW 1 140,537,398 (GRCm39) missense probably benign
R8171:Kcnt2 UTSW 1 140,437,203 (GRCm39) missense probably benign 0.13
R8268:Kcnt2 UTSW 1 140,450,954 (GRCm39) missense probably damaging 0.99
R8905:Kcnt2 UTSW 1 140,435,467 (GRCm39) missense possibly damaging 0.65
R8927:Kcnt2 UTSW 1 140,356,535 (GRCm39) splice site probably null
R8988:Kcnt2 UTSW 1 140,356,587 (GRCm39) missense probably benign 0.38
R9020:Kcnt2 UTSW 1 140,512,049 (GRCm39) missense probably benign 0.23
R9109:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9167:Kcnt2 UTSW 1 140,506,200 (GRCm39) missense probably benign 0.11
R9232:Kcnt2 UTSW 1 140,411,931 (GRCm39) missense possibly damaging 0.56
R9297:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9298:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9318:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9404:Kcnt2 UTSW 1 140,353,107 (GRCm39) missense probably damaging 1.00
X0062:Kcnt2 UTSW 1 140,440,729 (GRCm39) missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140,511,896 (GRCm39) nonsense probably null
Z1088:Kcnt2 UTSW 1 140,501,384 (GRCm39) missense probably damaging 1.00
Z1176:Kcnt2 UTSW 1 140,304,099 (GRCm39) missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140,537,386 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCCTCACAGTACTAACATGTTGG -3'
(R):5'- GGGGCTGTACCAGTTATATGAC -3'

Sequencing Primer
(F):5'- ATAGATCATTTTATGTGGTAGTGCC -3'
(R):5'- GCTGTACCAGTTATATGACTGCAGC -3'
Posted On 2014-08-25