Incidental Mutation 'R2005:Vangl1'
ID 225339
Institutional Source Beutler Lab
Gene Symbol Vangl1
Ensembl Gene ENSMUSG00000027860
Gene Name VANGL planar cell polarity 1
Synonyms mStbm, stbm, Lpp2, KITENIN
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R2005 (G1)
Quality Score 195
Status Not validated
Chromosome 3
Chromosomal Location 102153583-102204693 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102163466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 385 (S385P)
Ref Sequence ENSEMBL: ENSMUSP00000029453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000168312]
AlphaFold Q80Z96
Predicted Effect probably benign
Transcript: ENSMUST00000029453
AA Change: S385P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: S385P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 360 3.4e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159388
SMART Domains Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 25 526 8.6e-262 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160226
Predicted Effect unknown
Transcript: ENSMUST00000161021
AA Change: S111P
SMART Domains Protein: ENSMUSP00000125484
Gene: ENSMUSG00000027860
AA Change: S111P

DomainStartEndE-ValueType
Pfam:Strabismus 1 253 3.2e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162361
Predicted Effect probably benign
Transcript: ENSMUST00000168312
SMART Domains Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 357 1.2e-170 PFAM
Pfam:Strabismus 354 476 9.5e-67 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Vangl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Vangl1 APN 3 102158229 utr 3 prime probably benign
IGL00870:Vangl1 APN 3 102189440 missense probably damaging 1.00
IGL01533:Vangl1 APN 3 102163351 missense possibly damaging 0.88
IGL01981:Vangl1 APN 3 102184291 missense probably damaging 1.00
IGL02792:Vangl1 APN 3 102163423 missense probably damaging 0.98
IGL02800:Vangl1 APN 3 102163295 splice site probably benign
IGL02942:Vangl1 APN 3 102184031 missense probably damaging 1.00
IGL03029:Vangl1 APN 3 102184084 missense probably damaging 1.00
R0600:Vangl1 UTSW 3 102166937 missense probably damaging 1.00
R0904:Vangl1 UTSW 3 102183994 missense probably damaging 0.99
R1230:Vangl1 UTSW 3 102158293 missense probably benign 0.00
R1829:Vangl1 UTSW 3 102163466 missense probably benign
R2268:Vangl1 UTSW 3 102196844 missense probably damaging 1.00
R4181:Vangl1 UTSW 3 102165781 intron probably benign
R4662:Vangl1 UTSW 3 102166922 missense probably benign 0.00
R4724:Vangl1 UTSW 3 102184554 missense probably damaging 1.00
R4755:Vangl1 UTSW 3 102158292 missense probably benign 0.19
R5548:Vangl1 UTSW 3 102184446 missense possibly damaging 0.76
R5740:Vangl1 UTSW 3 102184134 missense probably damaging 0.99
R5758:Vangl1 UTSW 3 102184092 missense probably damaging 1.00
R6150:Vangl1 UTSW 3 102184519 missense probably damaging 1.00
R6373:Vangl1 UTSW 3 102158448 missense probably benign
R6943:Vangl1 UTSW 3 102165781 intron probably benign
R7474:Vangl1 UTSW 3 102184249 missense probably benign 0.22
R7616:Vangl1 UTSW 3 102184065 missense probably damaging 1.00
R8120:Vangl1 UTSW 3 102163442 nonsense probably null
R8827:Vangl1 UTSW 3 102163420 missense probably damaging 0.99
R8859:Vangl1 UTSW 3 102158442 missense
R9494:Vangl1 UTSW 3 102163349 missense probably damaging 0.98
R9745:Vangl1 UTSW 3 102165353 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAACCCAGGGACATTTCTGCC -3'
(R):5'- AGTATGACAGAGCCTTGGGG -3'

Sequencing Primer
(F):5'- ACCTAGCAGCGCACCTTG -3'
(R):5'- TATGACAGAGCCTTGGGGAAGTTG -3'
Posted On 2014-08-25