Incidental Mutation 'R2005:Skint7'
ID225346
Institutional Source Beutler Lab
Gene Symbol Skint7
Ensembl Gene ENSMUSG00000049214
Gene Nameselection and upkeep of intraepithelial T cells 7
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location111972923-111988223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111984850 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 305 (I305T)
Ref Sequence ENSEMBL: ENSMUSP00000127347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055014] [ENSMUST00000106568] [ENSMUST00000163281]
Predicted Effect probably benign
Transcript: ENSMUST00000055014
SMART Domains Protein: ENSMUSP00000054822
Gene: ENSMUSG00000049214

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106568
AA Change: I305T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102178
Gene: ENSMUSG00000049214
AA Change: I305T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142162
Predicted Effect probably benign
Transcript: ENSMUST00000163281
AA Change: I305T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127347
Gene: ENSMUSG00000049214
AA Change: I305T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Skint7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Skint7 APN 4 111982205 missense probably damaging 1.00
IGL01697:Skint7 APN 4 111980457 splice site probably benign
IGL01961:Skint7 APN 4 111977463 missense probably benign 0.01
IGL02232:Skint7 APN 4 111982028 missense possibly damaging 0.70
IGL02675:Skint7 APN 4 111981981 missense probably benign 0.03
IGL02729:Skint7 APN 4 111982170 missense probably benign 0.01
IGL02887:Skint7 APN 4 111982178 missense possibly damaging 0.70
ratio UTSW 4 111984876 splice site probably null
R0315:Skint7 UTSW 4 111988118 missense possibly damaging 0.61
R0401:Skint7 UTSW 4 111980362 missense probably damaging 0.96
R0545:Skint7 UTSW 4 111980198 missense probably benign 0.08
R0607:Skint7 UTSW 4 111977459 nonsense probably null
R0685:Skint7 UTSW 4 111980345 missense possibly damaging 0.71
R1130:Skint7 UTSW 4 111984158 missense probably benign 0.23
R1340:Skint7 UTSW 4 111980219 missense probably damaging 1.00
R1350:Skint7 UTSW 4 111980324 missense possibly damaging 0.78
R1764:Skint7 UTSW 4 111982073 missense probably benign 0.00
R1804:Skint7 UTSW 4 111982012 missense probably damaging 1.00
R2084:Skint7 UTSW 4 111980178 missense probably damaging 0.99
R4651:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R4652:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R5070:Skint7 UTSW 4 111984134 missense probably damaging 1.00
R5088:Skint7 UTSW 4 111980430 missense possibly damaging 0.78
R5096:Skint7 UTSW 4 111981955 missense probably damaging 0.98
R5311:Skint7 UTSW 4 111980304 missense probably damaging 0.99
R5524:Skint7 UTSW 4 111980349 missense probably damaging 1.00
R5777:Skint7 UTSW 4 111988092 missense probably benign 0.29
R6208:Skint7 UTSW 4 111984876 splice site probably null
R6369:Skint7 UTSW 4 111980293 missense probably benign 0.16
R6752:Skint7 UTSW 4 111980266 missense probably benign 0.21
R7396:Skint7 UTSW 4 111988127 missense probably benign
R7633:Skint7 UTSW 4 111984140 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGCATGAGATAGAAGTTAGTTGCC -3'
(R):5'- TGGAATCAATGAGAGCAGCTCC -3'

Sequencing Primer
(F):5'- ATGAGATAGAAGTTAGTTGCCTGTAG -3'
(R):5'- AATGAGAGCAGCTCCAGTCCTTG -3'
Posted On2014-08-25