Incidental Mutation 'R0144:Psmd2'
ID22535
Institutional Source Beutler Lab
Gene Symbol Psmd2
Ensembl Gene ENSMUSG00000006998
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 2
SynonymsTEG-190, Tex190, 9430095H01Rik
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0144 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20651652-20663414 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 20662225 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207]
Predicted Effect probably null
Transcript: ENSMUST00000007212
SMART Domains Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998

DomainStartEndE-ValueType
Pfam:PC_rep 443 479 3.7e-9 PFAM
Pfam:PC_rep 480 514 1.3e-8 PFAM
low complexity region 571 581 N/A INTRINSIC
SCOP:d1gw5b_ 617 773 1e-8 SMART
PDB:4CR4|Z 653 906 3e-57 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169184
Predicted Effect probably benign
Transcript: ENSMUST00000172207
Predicted Effect probably benign
Transcript: ENSMUST00000231897
Predicted Effect probably benign
Transcript: ENSMUST00000232513
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Psmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Psmd2 APN 16 20659405 utr 5 prime probably null
IGL02348:Psmd2 APN 16 20654647 missense probably benign 0.07
IGL02352:Psmd2 APN 16 20656941 missense probably benign 0.13
IGL02359:Psmd2 APN 16 20656941 missense probably benign 0.13
R0012:Psmd2 UTSW 16 20661684 missense probably damaging 0.99
R0565:Psmd2 UTSW 16 20660426 missense probably null 0.63
R0739:Psmd2 UTSW 16 20655329 missense probably benign 0.01
R1075:Psmd2 UTSW 16 20659959 missense probably damaging 0.98
R1189:Psmd2 UTSW 16 20661894 missense probably benign 0.17
R1231:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1466:Psmd2 UTSW 16 20657965 unclassified probably benign
R1556:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1843:Psmd2 UTSW 16 20656582 missense probably benign 0.02
R2398:Psmd2 UTSW 16 20659472 missense possibly damaging 0.86
R2421:Psmd2 UTSW 16 20660106 intron probably null
R2520:Psmd2 UTSW 16 20663076 missense probably damaging 1.00
R3040:Psmd2 UTSW 16 20657567 missense probably benign 0.08
R3905:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3906:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3909:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R4027:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4029:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4031:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4357:Psmd2 UTSW 16 20656652 missense probably benign
R4410:Psmd2 UTSW 16 20655026 missense probably damaging 0.96
R4678:Psmd2 UTSW 16 20659969 missense probably damaging 1.00
R4737:Psmd2 UTSW 16 20659815 unclassified probably benign
R4771:Psmd2 UTSW 16 20662679 missense probably damaging 0.99
R5081:Psmd2 UTSW 16 20661655 missense probably benign 0.14
R5124:Psmd2 UTSW 16 20652698 missense possibly damaging 0.93
R5801:Psmd2 UTSW 16 20654922 missense probably damaging 0.96
R6381:Psmd2 UTSW 16 20655273 missense probably benign 0.03
R6732:Psmd2 UTSW 16 20662636 missense probably benign 0.02
R6870:Psmd2 UTSW 16 20661843 missense probably benign 0.33
R7030:Psmd2 UTSW 16 20662133 missense probably damaging 1.00
R7137:Psmd2 UTSW 16 20652627 missense probably benign 0.12
R7432:Psmd2 UTSW 16 20654925 missense probably damaging 0.99
Z1176:Psmd2 UTSW 16 20662660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACCCCAATAACCTCTTCATGGTG -3'
(R):5'- TCAGGAATCTATCGCAGCCCTGAC -3'

Sequencing Primer
(F):5'- TTTGCCTGAGAAGGAACATGTC -3'
(R):5'- ATTACCTAAGAGCAAGCTCTGTTCC -3'
Posted On2013-04-16