Incidental Mutation 'R2005:Rpl9'
ID 225355
Institutional Source Beutler Lab
Gene Symbol Rpl9
Ensembl Gene ENSMUSG00000047215
Gene Name ribosomal protein L9
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 65545707-65548774 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65546878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 112 (V112I)
Ref Sequence ENSEMBL: ENSMUSP00000113704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031101] [ENSMUST00000057885] [ENSMUST00000118543] [ENSMUST00000120094] [ENSMUST00000122026] [ENSMUST00000200374] [ENSMUST00000127874]
AlphaFold P51410
Predicted Effect probably benign
Transcript: ENSMUST00000031101
SMART Domains Protein: ENSMUSP00000031101
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Pfam:LIAS_N 4 110 5.8e-49 PFAM
Elp3 126 332 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057885
AA Change: V112I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109399
Gene: ENSMUSG00000047215
AA Change: V112I

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 8.1e-18 PFAM
Pfam:Ribosomal_L6 99 178 7.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118543
AA Change: V112I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113391
Gene: ENSMUSG00000047215
AA Change: V112I

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.1e-19 PFAM
Pfam:Ribosomal_L6 99 165 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120094
AA Change: V112I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113704
Gene: ENSMUSG00000047215
AA Change: V112I

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 3e-17 PFAM
Pfam:Ribosomal_L6 99 178 2.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122026
SMART Domains Protein: ENSMUSP00000113228
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Elp3 42 248 1.42e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126036
Predicted Effect unknown
Transcript: ENSMUST00000196667
AA Change: V110I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139847
Predicted Effect probably benign
Transcript: ENSMUST00000200374
SMART Domains Protein: ENSMUSP00000143152
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Blast:Elp3 2 54 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150815
Predicted Effect probably benign
Transcript: ENSMUST00000127874
SMART Domains Protein: ENSMUSP00000115577
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 80 3.2e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L6P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Rpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03067:Rpl9 APN 5 65,548,191 (GRCm39) missense possibly damaging 0.67
R0082:Rpl9 UTSW 5 65,545,995 (GRCm39) missense probably benign 0.01
R5620:Rpl9 UTSW 5 65,546,468 (GRCm39) missense probably benign 0.03
R5910:Rpl9 UTSW 5 65,546,044 (GRCm39) unclassified probably benign
R7467:Rpl9 UTSW 5 65,548,310 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGAAAACCTCAAGCTCAGG -3'
(R):5'- ATGACAAAAGCACCTTAGGGC -3'

Sequencing Primer
(F):5'- TCAGGACCACCCAACAGTCTTC -3'
(R):5'- CACCTTAGGGCATTTAGAGCTGAC -3'
Posted On 2014-08-25