Mutagenetix > Incidental Mutation

Incidental Mutation 'R2005:Eif4h'

225356

Institutional Source

Beutler Lab

Gene Symbol

Eif4h

Ensembl Gene

ENSMUSG00000040731

Gene Name

eukaryotic translation initiation factor 4H

Synonyms

Eif4h, Wbscr1, E430026L18Rik, D5Ertd355e, Wscr1

MMRRC Submission

040014-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134619721-134639490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 134627677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 53 (T53I)

Ref Sequence

ENSEMBL: ENSMUSP00000143910 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036125] [ENSMUST00000202622]

AlphaFold

Q9WUK2

Predicted Effect

probably benign
Transcript: ENSMUST00000036125
AA Change: T53I

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000048833
Gene: ENSMUSG00000040731
AA Change: T53I

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
RRM	43	114	1.46e-16	SMART
low complexity region	136	147	N/A	INTRINSIC
low complexity region	164	179	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202289

Predicted Effect

probably benign
Transcript: ENSMUST00000202622
AA Change: T53I

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143910
Gene: ENSMUSG00000040731
AA Change: T53I

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
RRM	43	114	1.46e-16	SMART
low complexity region	136	147	N/A	INTRINSIC
low complexity region	164	179	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes eukaryotic translation initiation factor 4H (eIF4H) that plays a critical role in the process of protein synthesis. The encoded protein is an RNA-binding protein that, in concert with other translation initiation factors, helps unwind the 5' cap-proximal region of mRNA to prepare it for ribosomal attachment. Mice lacking the encoded protein displayed growth retardation with a significant reduction of body weight, a smaller brain volume and altered brain morphology. Behaviorally, mice lacking the encoded protein exhibit severe impairments of fear-related associative learning and memory formation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit growth defects and impaired cognitive behaviors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	G	A	12: 118,877,827	A961V	probably benign	Het
Adcy10	A	G	1: 165,525,022	Y475C	probably benign	Het
Adgrb3	T	C	1: 25,111,718	M1145V	probably benign	Het
Akr1c21	A	G	13: 4,574,215	T23A	probably damaging	Het
Ankrd33b	A	T	15: 31,297,668	S314R	probably damaging	Het
Apc	T	C	18: 34,310,909		probably null	Het
Atg9a	T	A	1: 75,185,991	Q460L	probably benign	Het
Birc3	C	T	9: 7,860,341	C292Y	probably damaging	Het
Capn5	T	C	7: 98,129,363	I350V	probably benign	Het
Cc2d2a	G	A	5: 43,726,373		probably null	Het
Cdh22	T	A	2: 165,180,923	E76V	probably damaging	Het
Cdh8	T	C	8: 99,033,471		probably null	Het
Cdkn1b	ATTCTTCTTC	ATTCTTCTTCTTC	6: 134,921,956		probably benign	Het
Cfap54	T	A	10: 92,884,768	D2608V	unknown	Het
Crebrf	T	C	17: 26,742,883	V318A	possibly damaging	Het
Cwf19l2	A	T	9: 3,430,720	N351Y	possibly damaging	Het
Cyp2c67	A	T	19: 39,643,345	M136K	probably damaging	Het
Ddx10	A	G	9: 53,240,475		probably null	Het
Ddx47	A	G	6: 135,018,121	N92S	probably benign	Het
Ddx50	T	A	10: 62,640,464	H306L	probably benign	Het
Dnajc27	A	G	12: 4,097,317	T167A	possibly damaging	Het
Dscam	T	G	16: 97,038,920	K162N	probably benign	Het
Elmo2	T	C	2: 165,298,279	N332S	probably benign	Het
Ergic3	A	G	2: 156,011,108	N157S	possibly damaging	Het
F2rl1	G	T	13: 95,513,274	R367S	probably damaging	Het
Fbxo36	G	A	1: 84,900,069	A151T	probably benign	Het
Foxf2	G	T	13: 31,626,141	R21L	unknown	Het
Gmip	T	A	8: 69,814,043	H269Q	probably benign	Het
Gng4	T	A	13: 13,806,166	V32E	probably benign	Het
Grm3	T	C	5: 9,589,793	Y84C	possibly damaging	Het
Helz2	C	T	2: 181,231,329	R2396H	probably benign	Het
Icosl	A	T	10: 78,071,953	M116L	possibly damaging	Het
Itgb3bp	A	C	4: 99,814,058	N16K	probably benign	Het
Kcnt2	A	G	1: 140,553,018	M824V	probably damaging	Het
Mki67	T	A	7: 135,698,509	K1599*	probably null	Het
Mmp25	G	A	17: 23,640,242	R144W	probably damaging	Het
Mmrn1	A	T	6: 60,976,084	I450F	possibly damaging	Het
Mroh2b	A	T	15: 4,917,158	K480M	probably damaging	Het
Nbn	T	A	4: 15,979,351	D445E	probably benign	Het
Npbwr1	T	A	1: 5,916,351	S315C	probably damaging	Het
Olfr1118	T	A	2: 87,309,448	S240T	probably benign	Het
Olfr1166	A	G	2: 88,124,547	L146P	probably damaging	Het
Olfr378	A	T	11: 73,425,239	V248E	probably damaging	Het
Olfr828	G	A	9: 18,815,505	S263L	probably benign	Het
Pard3b	A	T	1: 62,144,891	E183D	probably benign	Het
Pde10a	G	A	17: 8,929,091		probably null	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Prdm13	T	C	4: 21,685,695		probably benign	Het
Rc3h2	T	A	2: 37,389,753	K461*	probably null	Het
Reep2	C	T	18: 34,845,621	T117M	probably damaging	Het
Rhbdd1	A	G	1: 82,340,810	N138S	probably benign	Het
Rnf19a	A	T	15: 36,241,770	F708I	possibly damaging	Het
Robo2	G	A	16: 73,933,115	H1069Y	possibly damaging	Het
Rpl9	C	T	5: 65,389,535	V112I	probably benign	Het
Sec16a	A	C	2: 26,439,080	S974R	probably benign	Het
Sfrp5	A	G	19: 42,198,836	M265T	probably benign	Het
Skint7	T	C	4: 111,984,850	I305T	probably benign	Het
Slc6a7	T	C	18: 61,001,641	D454G	possibly damaging	Het
Slco6c1	A	G	1: 97,081,489	I407T	probably damaging	Het
Slfn8	A	T	11: 83,004,150	M610K	probably damaging	Het
Spidr	A	G	16: 16,048,049	S299P	probably damaging	Het
Sptbn4	C	T	7: 27,366,419	W2034*	probably null	Het
Stard9	T	A	2: 120,664,945	F100L	possibly damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stc1	T	C	14: 69,031,647		probably null	Het
Sun2	T	C	15: 79,726,624	E667G	possibly damaging	Het
Tacc2	T	C	7: 130,731,550	S511P	probably damaging	Het
Tasp1	T	G	2: 139,977,678	K202Q	probably damaging	Het
Tdrd6	A	G	17: 43,628,655	F501L	probably damaging	Het
Tgds	A	G	14: 118,130,656	V35A	possibly damaging	Het
Tubgcp6	G	A	15: 89,104,166	T860I	probably benign	Het
Twf1	C	T	15: 94,585,447		probably null	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn2r117	A	G	17: 23,477,644	I263T	probably damaging	Het
Washc5	A	G	15: 59,341,155	L892P	possibly damaging	Het
Wnk4	T	C	11: 101,263,890	C302R	probably damaging	Het
Zfp395	A	G	14: 65,388,885	E191G	possibly damaging	Het
Zkscan17	A	G	11: 59,492,216	L302P	probably damaging	Het

Other mutations in Eif4h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01470:Eif4h	APN	5	134625539	critical splice donor site	probably null
IGL02749:Eif4h	APN	5	134639292	missense	probably damaging	1.00
IGL02800:Eif4h	APN	5	134627605	missense	probably benign	0.08
R0184:Eif4h	UTSW	5	134625375	missense	possibly damaging	0.88
R1727:Eif4h	UTSW	5	134639280	missense	probably damaging	1.00
R8725:Eif4h	UTSW	5	134625539	critical splice donor site	probably null
R8727:Eif4h	UTSW	5	134625539	critical splice donor site	probably null
R9118:Eif4h	UTSW	5	134627627	missense	probably benign	0.24
R9676:Eif4h	UTSW	5	134639388	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TGATTTCCGCTCTGTGGAC -3'
(R):5'- TAAGGATGCTGGCCAGACAG -3'

Sequencing Primer
(F):5'- TCTGTGGACCAGGCTAACACAG -3'
(R):5'- CAGTGGGACAGAGGACATAGATTG -3'

Posted On

2014-08-25