Incidental Mutation 'R2005:Mmrn1'
ID 225360
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms Emilin4, 4921530G03Rik
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 60921301-60966362 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60953068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 450 (I450F)
Ref Sequence ENSEMBL: ENSMUSP00000145156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000129603
AA Change: I450F

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: I450F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204333
AA Change: I450F

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: I450F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60,954,497 (GRCm39) missense probably benign
IGL00742:Mmrn1 APN 6 60,935,104 (GRCm39) missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60,952,894 (GRCm39) nonsense probably null
IGL01121:Mmrn1 APN 6 60,952,928 (GRCm39) missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60,937,692 (GRCm39) splice site probably benign
IGL01697:Mmrn1 APN 6 60,953,477 (GRCm39) missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60,954,145 (GRCm39) missense probably benign
IGL01944:Mmrn1 APN 6 60,948,167 (GRCm39) critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60,921,557 (GRCm39) missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60,937,728 (GRCm39) missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60,964,177 (GRCm39) missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60,954,131 (GRCm39) missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60,921,806 (GRCm39) missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60,935,160 (GRCm39) missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60,950,030 (GRCm39) missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60,953,324 (GRCm39) missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60,921,876 (GRCm39) missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60,965,419 (GRCm39) missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60,952,819 (GRCm39) missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60,935,164 (GRCm39) missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60,953,017 (GRCm39) missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60,949,994 (GRCm39) missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60,952,799 (GRCm39) splice site probably benign
R0352:Mmrn1 UTSW 6 60,921,955 (GRCm39) missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60,954,099 (GRCm39) missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60,953,453 (GRCm39) missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60,950,103 (GRCm39) missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60,953,309 (GRCm39) missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60,953,306 (GRCm39) missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60,922,102 (GRCm39) missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60,921,755 (GRCm39) nonsense probably null
R1599:Mmrn1 UTSW 6 60,922,021 (GRCm39) missense probably benign
R1733:Mmrn1 UTSW 6 60,954,085 (GRCm39) missense probably benign 0.00
R2056:Mmrn1 UTSW 6 60,921,789 (GRCm39) missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60,922,059 (GRCm39) missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60,953,425 (GRCm39) missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60,921,831 (GRCm39) missense probably benign
R3837:Mmrn1 UTSW 6 60,921,831 (GRCm39) missense probably benign
R4206:Mmrn1 UTSW 6 60,935,164 (GRCm39) missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60,921,570 (GRCm39) missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60,937,797 (GRCm39) missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60,965,457 (GRCm39) missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60,950,027 (GRCm39) missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60,953,423 (GRCm39) missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60,953,474 (GRCm39) missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60,953,570 (GRCm39) missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60,964,058 (GRCm39) missense probably benign
R5917:Mmrn1 UTSW 6 60,950,134 (GRCm39) critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60,952,960 (GRCm39) missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60,964,168 (GRCm39) missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60,954,367 (GRCm39) missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60,965,524 (GRCm39) nonsense probably null
R7073:Mmrn1 UTSW 6 60,965,411 (GRCm39) missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60,921,527 (GRCm39) start gained probably benign
R7256:Mmrn1 UTSW 6 60,953,098 (GRCm39) missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60,921,917 (GRCm39) nonsense probably null
R7350:Mmrn1 UTSW 6 60,953,320 (GRCm39) nonsense probably null
R7388:Mmrn1 UTSW 6 60,953,236 (GRCm39) missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60,954,490 (GRCm39) missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60,953,689 (GRCm39) missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60,953,309 (GRCm39) missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60,964,044 (GRCm39) splice site probably null
R7979:Mmrn1 UTSW 6 60,952,961 (GRCm39) missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60,921,508 (GRCm39) start gained probably benign
R8130:Mmrn1 UTSW 6 60,937,707 (GRCm39) missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60,954,220 (GRCm39) missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60,965,361 (GRCm39) missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60,965,361 (GRCm39) missense probably damaging 1.00
R8472:Mmrn1 UTSW 6 60,965,380 (GRCm39) missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60,964,193 (GRCm39) missense possibly damaging 0.54
R8803:Mmrn1 UTSW 6 60,965,271 (GRCm39) missense probably damaging 1.00
R8879:Mmrn1 UTSW 6 60,953,513 (GRCm39) missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60,953,077 (GRCm39) missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60,953,042 (GRCm39) missense probably benign 0.04
R9200:Mmrn1 UTSW 6 60,953,860 (GRCm39) missense probably damaging 1.00
R9287:Mmrn1 UTSW 6 60,952,939 (GRCm39) missense probably damaging 1.00
R9387:Mmrn1 UTSW 6 60,935,176 (GRCm39) nonsense probably null
R9612:Mmrn1 UTSW 6 60,953,408 (GRCm39) missense probably damaging 0.96
R9674:Mmrn1 UTSW 6 60,948,072 (GRCm39) nonsense probably null
X0026:Mmrn1 UTSW 6 60,952,997 (GRCm39) missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60,922,018 (GRCm39) missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60,964,082 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCTTCCAAGATGATATGCAGGAG -3'
(R):5'- GGCGACATTCTCTGTTCCTG -3'

Sequencing Primer
(F):5'- GACTGCCCAGATCTTCAAGACTG -3'
(R):5'- ACTTGTAGAACTGATAACAGCTGTG -3'
Posted On 2014-08-25