Incidental Mutation 'R2005:Ddx47'
ID 225364
Institutional Source Beutler Lab
Gene Symbol Ddx47
Ensembl Gene ENSMUSG00000030204
Gene Name DEAD box helicase 47
Synonyms 4930588A18Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 134988575-135000739 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134995084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 92 (N92S)
Ref Sequence ENSEMBL: ENSMUSP00000115183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032326] [ENSMUST00000130851] [ENSMUST00000205055] [ENSMUST00000205244]
AlphaFold Q9CWX9
Predicted Effect probably benign
Transcript: ENSMUST00000032326
AA Change: N274S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032326
Gene: ENSMUSG00000030204
AA Change: N274S

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 241 6.38e-61 SMART
HELICc 277 358 8.21e-32 SMART
low complexity region 413 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123022
Predicted Effect probably benign
Transcript: ENSMUST00000130851
AA Change: N92S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115183
Gene: ENSMUSG00000030204
AA Change: N92S

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
Blast:DEXDc 30 59 9e-12 BLAST
Pfam:Helicase_C 99 138 2.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134549
Predicted Effect probably benign
Transcript: ENSMUST00000154558
SMART Domains Protein: ENSMUSP00000119231
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
low complexity region 13 20 N/A INTRINSIC
DEXDc 40 238 6.38e-61 SMART
HELICc 229 306 3.67e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155698
Predicted Effect unknown
Transcript: ENSMUST00000204646
AA Change: N249S
Predicted Effect probably benign
Transcript: ENSMUST00000205055
SMART Domains Protein: ENSMUSP00000145463
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 178 1.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205244
SMART Domains Protein: ENSMUSP00000145139
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
DEXDc 6 178 3e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Ddx47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02719:Ddx47 APN 6 134,994,114 (GRCm39) missense probably benign 0.06
PIT4466001:Ddx47 UTSW 6 134,992,803 (GRCm39) missense probably benign 0.31
R0304:Ddx47 UTSW 6 134,994,183 (GRCm39) missense possibly damaging 0.62
R0617:Ddx47 UTSW 6 134,994,085 (GRCm39) missense probably damaging 1.00
R1223:Ddx47 UTSW 6 134,989,277 (GRCm39) missense possibly damaging 0.70
R1468:Ddx47 UTSW 6 134,988,703 (GRCm39) splice site probably benign
R2134:Ddx47 UTSW 6 134,992,313 (GRCm39) nonsense probably null
R2993:Ddx47 UTSW 6 134,995,944 (GRCm39) missense probably damaging 1.00
R3714:Ddx47 UTSW 6 134,996,025 (GRCm39) missense probably damaging 1.00
R4352:Ddx47 UTSW 6 134,995,018 (GRCm39) missense probably benign 0.38
R4355:Ddx47 UTSW 6 134,998,468 (GRCm39) missense probably benign
R4495:Ddx47 UTSW 6 134,998,429 (GRCm39) missense possibly damaging 0.62
R4664:Ddx47 UTSW 6 134,989,319 (GRCm39) missense possibly damaging 0.95
R5527:Ddx47 UTSW 6 134,988,657 (GRCm39) missense probably benign 0.35
R6119:Ddx47 UTSW 6 135,000,318 (GRCm39) missense probably benign
R7038:Ddx47 UTSW 6 135,000,336 (GRCm39) missense possibly damaging 0.84
R7270:Ddx47 UTSW 6 135,000,301 (GRCm39) missense probably benign 0.08
R8855:Ddx47 UTSW 6 135,000,356 (GRCm39) missense probably benign 0.06
R8866:Ddx47 UTSW 6 135,000,356 (GRCm39) missense probably benign 0.06
X0026:Ddx47 UTSW 6 135,000,352 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCAATCAGGAAGTACAGGC -3'
(R):5'- GCACACAAGACCAGGATGTG -3'

Sequencing Primer
(F):5'- CCTCTGATAGTTGTGCCAACAAGG -3'
(R):5'- CCAGGATGTGCAAGGAGC -3'
Posted On 2014-08-25