Incidental Mutation 'R2005:Sptbn4'
ID 225368
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Name spectrin beta, non-erythrocytic 4
Synonyms nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.391) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 27055808-27147111 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 27065844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 2034 (W2034*)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
AlphaFold E9PX29
Predicted Effect probably null
Transcript: ENSMUST00000011895
AA Change: W2039*
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: W2039*

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108362
AA Change: W719*
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: W719*

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108363
AA Change: W719*
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: W719*

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108364
AA Change: W719*
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: W719*

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172269
AA Change: W2034*
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: W2034*

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27,068,859 (GRCm39) missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27,117,390 (GRCm39) missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27,114,196 (GRCm39) missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27,103,693 (GRCm39) missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27,063,571 (GRCm39) missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27,063,940 (GRCm39) missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27,063,782 (GRCm39) missense probably benign
IGL02226:Sptbn4 APN 7 27,065,132 (GRCm39) missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27,063,724 (GRCm39) missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27,127,672 (GRCm39) missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27,065,014 (GRCm39) missense probably null 0.15
IGL02487:Sptbn4 APN 7 27,118,522 (GRCm39) missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27,090,976 (GRCm39) missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27,067,104 (GRCm39) missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27,093,573 (GRCm39) splice site probably benign
IGL02961:Sptbn4 APN 7 27,097,392 (GRCm39) missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27,056,812 (GRCm39) nonsense probably null
R0194:Sptbn4 UTSW 7 27,104,336 (GRCm39) missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27,059,161 (GRCm39) splice site probably benign
R0510:Sptbn4 UTSW 7 27,060,991 (GRCm39) critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27,063,803 (GRCm39) missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27,107,753 (GRCm39) nonsense probably null
R1336:Sptbn4 UTSW 7 27,117,388 (GRCm39) missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27,133,719 (GRCm39) missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27,118,164 (GRCm39) missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27,118,008 (GRCm39) missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27,066,071 (GRCm39) missense probably null 0.96
R1906:Sptbn4 UTSW 7 27,090,856 (GRCm39) critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27,106,563 (GRCm39) missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27,065,868 (GRCm39) missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27,123,235 (GRCm39) missense probably benign 0.19
R2083:Sptbn4 UTSW 7 27,127,681 (GRCm39) missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27,063,587 (GRCm39) missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27,067,034 (GRCm39) missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27,059,517 (GRCm39) missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27,117,523 (GRCm39) nonsense probably null
R4115:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27,117,896 (GRCm39) missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27,123,223 (GRCm39) missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27,066,160 (GRCm39) missense possibly damaging 0.60
R4684:Sptbn4 UTSW 7 27,063,844 (GRCm39) missense probably damaging 0.96
R4707:Sptbn4 UTSW 7 27,116,431 (GRCm39) missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27,071,577 (GRCm39) missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27,068,816 (GRCm39) missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27,059,166 (GRCm39) critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27,065,853 (GRCm39) missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27,118,138 (GRCm39) missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27,103,678 (GRCm39) missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27,071,596 (GRCm39) missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27,118,024 (GRCm39) missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27,063,904 (GRCm39) missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27,059,513 (GRCm39) missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27,064,012 (GRCm39) nonsense probably null
R6762:Sptbn4 UTSW 7 27,093,633 (GRCm39) missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27,071,375 (GRCm39) missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27,117,481 (GRCm39) missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27,116,210 (GRCm39) missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27,066,114 (GRCm39) missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27,108,439 (GRCm39) missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27,127,693 (GRCm39) missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27,075,015 (GRCm39) missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27,141,960 (GRCm39) missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27,071,697 (GRCm39) missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27,061,002 (GRCm39) missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27,063,761 (GRCm39) missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27,061,059 (GRCm39) missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27,061,835 (GRCm39) missense probably benign
R8002:Sptbn4 UTSW 7 27,117,417 (GRCm39) missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27,063,694 (GRCm39) missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27,074,808 (GRCm39) missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27,108,314 (GRCm39) nonsense probably null
R8353:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27,071,721 (GRCm39) missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8815:Sptbn4 UTSW 7 27,106,657 (GRCm39) nonsense probably null
R8818:Sptbn4 UTSW 7 27,063,592 (GRCm39) missense possibly damaging 0.71
R9171:Sptbn4 UTSW 7 27,141,844 (GRCm39) missense possibly damaging 0.95
R9259:Sptbn4 UTSW 7 27,067,124 (GRCm39) missense possibly damaging 0.74
R9477:Sptbn4 UTSW 7 27,132,624 (GRCm39) missense possibly damaging 0.79
R9564:Sptbn4 UTSW 7 27,117,504 (GRCm39) missense probably damaging 0.98
R9572:Sptbn4 UTSW 7 27,066,095 (GRCm39) missense probably benign 0.16
R9623:Sptbn4 UTSW 7 27,107,807 (GRCm39) missense probably damaging 1.00
R9715:Sptbn4 UTSW 7 27,091,000 (GRCm39) missense probably damaging 1.00
R9782:Sptbn4 UTSW 7 27,107,993 (GRCm39) missense probably benign 0.02
R9790:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9791:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9798:Sptbn4 UTSW 7 27,056,717 (GRCm39) makesense probably null
X0020:Sptbn4 UTSW 7 27,102,159 (GRCm39) critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27,056,736 (GRCm39) unclassified probably benign
Z1176:Sptbn4 UTSW 7 27,059,450 (GRCm39) missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27,108,527 (GRCm39) missense probably benign 0.41
Z1177:Sptbn4 UTSW 7 27,104,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGTTTCTAAAGATACCAACACC -3'
(R):5'- CAACAAAAGCGCCATGGCTG -3'

Sequencing Primer
(F):5'- TTTCTAAAGATACCAACACCCCTCTC -3'
(R):5'- AGCGCCATGGCTGATGAG -3'
Posted On 2014-08-25