Incidental Mutation 'R2005:Tacc2'
ID 225372
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Name transforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2005 (G1)
Quality Score 206
Status Not validated
Chromosome 7
Chromosomal Location 130179168-130366515 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130333280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 511 (S511P)
Ref Sequence ENSEMBL: ENSMUSP00000147134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033141] [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207282] [ENSMUST00000207376] [ENSMUST00000207395] [ENSMUST00000207549] [ENSMUST00000207789] [ENSMUST00000208743] [ENSMUST00000208722] [ENSMUST00000209108]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033141
AA Change: S511P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033141
Gene: ENSMUSG00000030852
AA Change: S511P

DomainStartEndE-ValueType
low complexity region 37 63 N/A INTRINSIC
internal_repeat_1 71 181 1.04e-5 PROSPERO
low complexity region 235 246 N/A INTRINSIC
internal_repeat_2 258 345 6.53e-5 PROSPERO
internal_repeat_1 373 456 1.04e-5 PROSPERO
low complexity region 461 476 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
internal_repeat_2 629 716 6.53e-5 PROSPERO
coiled coil region 763 790 N/A INTRINSIC
Pfam:TACC 829 1035 3.4e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000059145
AA Change: S621P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: S621P

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084513
AA Change: S2328P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: S2328P

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207282
Predicted Effect probably benign
Transcript: ENSMUST00000207376
Predicted Effect probably benign
Transcript: ENSMUST00000207395
Predicted Effect probably benign
Transcript: ENSMUST00000207549
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably damaging
Transcript: ENSMUST00000208743
AA Change: S511P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208722
AA Change: S621P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209108
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130,360,898 (GRCm39) missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130,360,919 (GRCm39) missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130,331,498 (GRCm39) missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130,330,898 (GRCm39) splice site probably null
IGL02075:Tacc2 APN 7 130,330,582 (GRCm39) missense probably benign 0.03
IGL02201:Tacc2 APN 7 130,227,942 (GRCm39) missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130,228,412 (GRCm39) missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130,225,129 (GRCm39) missense probably benign 0.15
IGL02456:Tacc2 APN 7 130,227,991 (GRCm39) missense probably benign 0.35
IGL02559:Tacc2 APN 7 130,360,997 (GRCm39) missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130,227,829 (GRCm39) missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130,225,809 (GRCm39) missense probably benign 0.40
IGL02938:Tacc2 APN 7 130,330,671 (GRCm39) missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130,225,585 (GRCm39) missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130,335,298 (GRCm39) critical splice donor site probably null
IGL03283:Tacc2 APN 7 130,343,996 (GRCm39) missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130,227,791 (GRCm39) missense possibly damaging 0.90
aces UTSW 7 130,335,258 (GRCm39) missense probably damaging 1.00
Jacks UTSW 7 130,227,494 (GRCm39) missense probably damaging 0.98
kings UTSW 7 130,225,213 (GRCm39) missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130,223,515 (GRCm39) missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130,223,605 (GRCm39) missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130,353,555 (GRCm39) splice site probably benign
R0619:Tacc2 UTSW 7 130,318,483 (GRCm39) missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130,179,239 (GRCm39) missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130,227,325 (GRCm39) nonsense probably null
R1015:Tacc2 UTSW 7 130,225,795 (GRCm39) missense probably benign
R1081:Tacc2 UTSW 7 130,330,304 (GRCm39) missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130,228,227 (GRCm39) missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130,264,733 (GRCm39) intron probably benign
R1538:Tacc2 UTSW 7 130,227,149 (GRCm39) missense probably benign 0.03
R1743:Tacc2 UTSW 7 130,228,328 (GRCm39) nonsense probably null
R1771:Tacc2 UTSW 7 130,343,970 (GRCm39) missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130,225,475 (GRCm39) missense probably benign 0.38
R1893:Tacc2 UTSW 7 130,227,055 (GRCm39) missense probably benign 0.01
R1899:Tacc2 UTSW 7 130,225,932 (GRCm39) missense possibly damaging 0.81
R2131:Tacc2 UTSW 7 130,223,587 (GRCm39) missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130,335,299 (GRCm39) splice site probably null
R2407:Tacc2 UTSW 7 130,223,770 (GRCm39) missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130,227,226 (GRCm39) missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130,227,226 (GRCm39) missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130,227,226 (GRCm39) missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130,360,979 (GRCm39) missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130,336,724 (GRCm39) missense probably benign 0.02
R3683:Tacc2 UTSW 7 130,226,800 (GRCm39) missense probably benign 0.40
R3685:Tacc2 UTSW 7 130,226,800 (GRCm39) missense probably benign 0.40
R3872:Tacc2 UTSW 7 130,224,152 (GRCm39) missense probably benign 0.02
R4063:Tacc2 UTSW 7 130,330,852 (GRCm39) missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130,343,941 (GRCm39) missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130,225,271 (GRCm39) missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130,225,271 (GRCm39) missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130,227,946 (GRCm39) missense probably benign 0.10
R4674:Tacc2 UTSW 7 130,226,591 (GRCm39) missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130,227,697 (GRCm39) missense probably benign 0.00
R4934:Tacc2 UTSW 7 130,330,318 (GRCm39) missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130,227,629 (GRCm39) missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130,330,507 (GRCm39) missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130,330,507 (GRCm39) missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130,225,678 (GRCm39) missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130,336,744 (GRCm39) missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130,331,047 (GRCm39) missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130,335,258 (GRCm39) missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130,335,258 (GRCm39) missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130,224,990 (GRCm39) missense probably benign 0.09
R5556:Tacc2 UTSW 7 130,276,336 (GRCm39) missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130,225,781 (GRCm39) missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130,330,850 (GRCm39) missense probably benign 0.18
R5996:Tacc2 UTSW 7 130,225,213 (GRCm39) missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130,227,165 (GRCm39) missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130,227,845 (GRCm39) missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130,227,494 (GRCm39) missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130,228,255 (GRCm39) missense probably benign 0.26
R6444:Tacc2 UTSW 7 130,225,142 (GRCm39) missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130,224,567 (GRCm39) missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130,330,492 (GRCm39) missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130,330,618 (GRCm39) missense probably benign 0.16
R7150:Tacc2 UTSW 7 130,330,807 (GRCm39) missense probably benign
R7290:Tacc2 UTSW 7 130,331,103 (GRCm39) missense probably benign 0.07
R7404:Tacc2 UTSW 7 130,225,066 (GRCm39) missense probably benign 0.22
R7460:Tacc2 UTSW 7 130,226,363 (GRCm39) missense probably benign 0.39
R7651:Tacc2 UTSW 7 130,224,884 (GRCm39) missense probably benign 0.25
R7666:Tacc2 UTSW 7 130,318,544 (GRCm39) start gained probably benign
R7695:Tacc2 UTSW 7 130,330,633 (GRCm39) missense probably benign 0.08
R7766:Tacc2 UTSW 7 130,345,328 (GRCm39) missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130,224,843 (GRCm39) missense probably benign 0.34
R7861:Tacc2 UTSW 7 130,227,161 (GRCm39) missense probably benign 0.00
R8204:Tacc2 UTSW 7 130,226,159 (GRCm39) missense probably damaging 0.97
R8244:Tacc2 UTSW 7 130,330,406 (GRCm39) missense probably damaging 1.00
R8245:Tacc2 UTSW 7 130,331,303 (GRCm39) missense probably damaging 1.00
R8283:Tacc2 UTSW 7 130,227,034 (GRCm39) missense probably benign 0.02
R8348:Tacc2 UTSW 7 130,225,019 (GRCm39) missense possibly damaging 0.84
R8369:Tacc2 UTSW 7 130,223,888 (GRCm39) missense probably damaging 0.98
R8381:Tacc2 UTSW 7 130,225,972 (GRCm39) missense probably benign 0.00
R8804:Tacc2 UTSW 7 130,294,693 (GRCm39) missense probably benign
R8809:Tacc2 UTSW 7 130,276,421 (GRCm39) missense possibly damaging 0.94
R8835:Tacc2 UTSW 7 130,228,258 (GRCm39) missense probably benign 0.00
R8880:Tacc2 UTSW 7 130,318,564 (GRCm39) missense possibly damaging 0.86
R8918:Tacc2 UTSW 7 130,227,823 (GRCm39) missense probably benign 0.00
R8936:Tacc2 UTSW 7 130,228,367 (GRCm39) missense possibly damaging 0.94
R8953:Tacc2 UTSW 7 130,227,487 (GRCm39) missense probably benign 0.00
R9026:Tacc2 UTSW 7 130,225,266 (GRCm39) missense probably damaging 1.00
R9193:Tacc2 UTSW 7 130,228,304 (GRCm39) missense probably benign 0.04
R9221:Tacc2 UTSW 7 130,226,209 (GRCm39) missense probably benign 0.00
R9221:Tacc2 UTSW 7 130,226,058 (GRCm39) missense probably damaging 0.98
R9222:Tacc2 UTSW 7 130,227,985 (GRCm39) missense probably benign 0.00
R9264:Tacc2 UTSW 7 130,228,533 (GRCm39) missense probably damaging 1.00
R9312:Tacc2 UTSW 7 130,223,978 (GRCm39) missense probably benign 0.00
R9380:Tacc2 UTSW 7 130,226,771 (GRCm39) missense possibly damaging 0.86
R9515:Tacc2 UTSW 7 130,366,041 (GRCm39) missense probably damaging 1.00
R9705:Tacc2 UTSW 7 130,361,018 (GRCm39) missense probably damaging 1.00
X0010:Tacc2 UTSW 7 130,336,787 (GRCm39) missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130,346,327 (GRCm39) missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130,226,000 (GRCm39) missense possibly damaging 0.59
Z1176:Tacc2 UTSW 7 130,225,100 (GRCm39) missense probably benign 0.01
Z1177:Tacc2 UTSW 7 130,336,679 (GRCm39) missense possibly damaging 0.96
Z1177:Tacc2 UTSW 7 130,227,504 (GRCm39) missense probably damaging 0.99
Z1177:Tacc2 UTSW 7 130,226,710 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAGAGGAAGCTGTATC -3'
(R):5'- CAGTCTCATGCTGATCACAGTG -3'

Sequencing Primer
(F):5'- GTATCCAGGCAGCCCCTTC -3'
(R):5'- CTCATGCTGATCACAGTGTGGAG -3'
Posted On 2014-08-25