Incidental Mutation 'R0144:Btnl6'
ID22538
Institutional Source Beutler Lab
Gene Symbol Btnl6
Ensembl Gene ENSMUSG00000092618
Gene Namebutyrophilin-like 6
SynonymsGm6519, NG13
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0144 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34507804-34517352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34514020 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 290 (R290S)
Ref Sequence ENSEMBL: ENSMUSP00000074927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075483]
Predicted Effect probably benign
Transcript: ENSMUST00000075483
AA Change: R290S

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074927
Gene: ENSMUSG00000092618
AA Change: R290S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.06e-5 SMART
SCOP:d1c5ch2 151 222 1e-2 SMART
Blast:IG_like 152 228 2e-23 BLAST
transmembrane domain 252 271 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
SPRY 384 509 1.23e-19 SMART
low complexity region 510 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173164
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Btnl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Btnl6 APN 17 34514043 missense probably benign 0.00
IGL02501:Btnl6 APN 17 34515674 missense possibly damaging 0.82
IGL02539:Btnl6 APN 17 34508314 missense probably benign 0.00
IGL02629:Btnl6 APN 17 34514468 missense probably damaging 1.00
IGL02724:Btnl6 APN 17 34508175 nonsense probably null
IGL03366:Btnl6 APN 17 34508179 missense probably damaging 1.00
R0013:Btnl6 UTSW 17 34515531 nonsense probably null
R0025:Btnl6 UTSW 17 34514299 missense probably benign 0.02
R0255:Btnl6 UTSW 17 34508503 missense probably benign 0.01
R1474:Btnl6 UTSW 17 34513646 missense probably damaging 1.00
R1757:Btnl6 UTSW 17 34514088 missense probably benign 0.09
R1838:Btnl6 UTSW 17 34515542 missense probably damaging 0.99
R2149:Btnl6 UTSW 17 34514347 missense possibly damaging 0.47
R2994:Btnl6 UTSW 17 34515524 missense possibly damaging 0.82
R3441:Btnl6 UTSW 17 34508318 missense probably benign 0.06
R3809:Btnl6 UTSW 17 34508228 missense probably benign 0.00
R3936:Btnl6 UTSW 17 34517342 missense probably benign
R4462:Btnl6 UTSW 17 34508057 missense probably damaging 1.00
R4604:Btnl6 UTSW 17 34508461 missense possibly damaging 0.91
R4618:Btnl6 UTSW 17 34514146 missense probably damaging 0.98
R4832:Btnl6 UTSW 17 34513992 missense possibly damaging 0.80
R5369:Btnl6 UTSW 17 34507985 nonsense probably null
R5422:Btnl6 UTSW 17 34514107 missense possibly damaging 0.93
R6046:Btnl6 UTSW 17 34508397 missense probably damaging 1.00
R6170:Btnl6 UTSW 17 34515506 missense probably damaging 0.99
R6385:Btnl6 UTSW 17 34508369 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTTCCTTTGAGCTGAAAAGCAAC -3'
(R):5'- ACAGAGCCCTTCTTTCCCAAGGTC -3'

Sequencing Primer
(F):5'- GGGTTCCTGATTCTCTGAACTACAG -3'
(R):5'- AAGGTCTCTCCCTGGAAGC -3'
Posted On2013-04-16