Incidental Mutation 'R2005:Birc2'
ID 225382
Institutional Source Beutler Lab
Gene Symbol Birc2
Ensembl Gene ENSMUSG00000057367
Gene Name baculoviral IAP repeat-containing 2
Synonyms cIAP1, Api1, HIAP1, cIAP-1, MIAP1, mcIAP1, MIHB, IAP1
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.906) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 7818228-7837065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7860342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 292 (C292Y)
Ref Sequence ENSEMBL: ENSMUSP00000111336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013949] [ENSMUST00000115672] [ENSMUST00000115673] [ENSMUST00000159323]
AlphaFold Q62210
Predicted Effect probably damaging
Transcript: ENSMUST00000013949
AA Change: C292Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013949
Gene: ENSMUSG00000032000
AA Change: C292Y

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
CARD 438 525 7.29e-4 SMART
RING 555 589 1.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115672
AA Change: C292Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111336
Gene: ENSMUSG00000032000
AA Change: C292Y

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115673
SMART Domains Protein: ENSMUSP00000111337
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159323
SMART Domains Protein: ENSMUSP00000125652
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161642
SMART Domains Protein: ENSMUSP00000125512
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
SCOP:d1g73d_ 4 35 1e-6 SMART
PDB:3T6P|A 4 106 2e-39 PDB
low complexity region 107 125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice showed a modest reduction in the number of lymphocytes. Mice homozygous for a knock-in allele exhibit increased T cell poliferation and IFNG secretion in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Birc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Birc2 APN 9 7,833,666 (GRCm39) missense probably damaging 1.00
IGL00972:Birc2 APN 9 7,833,716 (GRCm39) missense probably benign 0.36
IGL01329:Birc2 APN 9 7,860,733 (GRCm39) missense probably damaging 1.00
IGL02852:Birc2 APN 9 7,854,484 (GRCm39) missense probably damaging 0.99
IGL02888:Birc2 APN 9 7,819,559 (GRCm39) missense probably benign 0.22
IGL03135:Birc2 APN 9 7,849,722 (GRCm39) splice site probably benign
IGL03399:Birc2 APN 9 7,821,088 (GRCm39) missense probably damaging 1.00
1mM(1):Birc2 UTSW 9 7,819,409 (GRCm39) missense probably damaging 0.98
R0409:Birc2 UTSW 9 7,819,385 (GRCm39) missense possibly damaging 0.61
R0478:Birc2 UTSW 9 7,860,348 (GRCm39) missense probably damaging 1.00
R0905:Birc2 UTSW 9 7,851,052 (GRCm39) makesense probably null
R1617:Birc2 UTSW 9 7,826,952 (GRCm39) missense possibly damaging 0.66
R1864:Birc2 UTSW 9 7,819,518 (GRCm39) missense probably benign 0.06
R1934:Birc2 UTSW 9 7,854,500 (GRCm39) missense possibly damaging 0.89
R2156:Birc2 UTSW 9 7,826,939 (GRCm39) missense probably damaging 1.00
R2519:Birc2 UTSW 9 7,821,180 (GRCm39) missense possibly damaging 0.46
R2867:Birc2 UTSW 9 7,834,478 (GRCm39) start codon destroyed probably null 0.08
R2867:Birc2 UTSW 9 7,834,478 (GRCm39) start codon destroyed probably null 0.08
R3019:Birc2 UTSW 9 7,857,390 (GRCm39) critical splice donor site probably null
R4028:Birc2 UTSW 9 7,819,352 (GRCm39) missense probably benign 0.01
R4169:Birc2 UTSW 9 7,849,684 (GRCm39) missense possibly damaging 0.78
R4243:Birc2 UTSW 9 7,834,386 (GRCm39) missense probably benign 0.00
R4250:Birc2 UTSW 9 7,818,936 (GRCm39) missense probably benign 0.00
R4584:Birc2 UTSW 9 7,833,675 (GRCm39) missense probably damaging 1.00
R4952:Birc2 UTSW 9 7,836,741 (GRCm39) missense probably damaging 0.99
R4964:Birc2 UTSW 9 7,860,553 (GRCm39) missense probably benign 0.01
R5017:Birc2 UTSW 9 7,818,886 (GRCm39) nonsense probably null
R5338:Birc2 UTSW 9 7,857,360 (GRCm39) missense probably benign 0.01
R5395:Birc2 UTSW 9 7,861,175 (GRCm39) missense probably damaging 1.00
R5877:Birc2 UTSW 9 7,849,347 (GRCm39) missense probably damaging 1.00
R5914:Birc2 UTSW 9 7,857,343 (GRCm39) makesense probably null
R6148:Birc2 UTSW 9 7,849,684 (GRCm39) missense possibly damaging 0.78
R6163:Birc2 UTSW 9 7,819,036 (GRCm39) missense probably benign 0.15
R6471:Birc2 UTSW 9 7,857,421 (GRCm39) missense probably benign 0.00
R6747:Birc2 UTSW 9 7,860,262 (GRCm39) critical splice donor site probably null
R6752:Birc2 UTSW 9 7,857,345 (GRCm39) missense probably benign 0.10
R6789:Birc2 UTSW 9 7,836,966 (GRCm39) intron probably benign
R6795:Birc2 UTSW 9 7,833,873 (GRCm39) missense possibly damaging 0.81
R6812:Birc2 UTSW 9 7,854,418 (GRCm39) missense probably damaging 0.99
R6941:Birc2 UTSW 9 7,819,469 (GRCm39) missense probably benign 0.00
R7105:Birc2 UTSW 9 7,819,442 (GRCm39) missense probably damaging 1.00
R7135:Birc2 UTSW 9 7,818,762 (GRCm39) missense probably damaging 1.00
R7233:Birc2 UTSW 9 7,827,009 (GRCm39) missense probably damaging 1.00
R7460:Birc2 UTSW 9 7,818,762 (GRCm39) missense probably damaging 1.00
R7517:Birc2 UTSW 9 7,819,424 (GRCm39) missense probably benign 0.00
R8078:Birc2 UTSW 9 7,858,742 (GRCm39) missense probably damaging 0.98
R8101:Birc2 UTSW 9 7,861,005 (GRCm39) missense probably benign 0.00
R8146:Birc2 UTSW 9 7,818,797 (GRCm39) missense probably damaging 1.00
R8314:Birc2 UTSW 9 7,872,942 (GRCm39) intron probably benign
R8371:Birc2 UTSW 9 7,849,427 (GRCm39) missense probably damaging 1.00
R8396:Birc2 UTSW 9 7,834,301 (GRCm39) missense probably benign 0.05
R9009:Birc2 UTSW 9 7,833,937 (GRCm39) missense probably benign
R9497:Birc2 UTSW 9 7,861,028 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAACTATCACAATGCAAAGCACTTAA -3'
(R):5'- GTGCACTAGTTCATTCCCAGGA -3'

Sequencing Primer
(F):5'- TCTAGAAGTCTAGTCACAGAGGCTC -3'
(R):5'- TTCCCAGGAACTTGCAAGTG -3'
Posted On 2014-08-25