Incidental Mutation 'R2005:Ddx10'
ID 225386
Institutional Source Beutler Lab
Gene Symbol Ddx10
Ensembl Gene ENSMUSG00000053289
Gene Name DEAD box helicase 10
Synonyms 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 53009935-53159353 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 53151775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065630]
AlphaFold Q80Y44
Predicted Effect probably null
Transcript: ENSMUST00000065630
SMART Domains Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
DEXDc 88 291 1.74e-53 SMART
HELICc 327 410 8.48e-25 SMART
DUF4217 450 513 6.06e-25 SMART
low complexity region 577 594 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 658 680 N/A INTRINSIC
low complexity region 748 773 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Ddx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ddx10 APN 9 53,071,326 (GRCm39) splice site probably benign
IGL01111:Ddx10 APN 9 53,071,248 (GRCm39) missense possibly damaging 0.73
IGL01773:Ddx10 APN 9 53,115,430 (GRCm39) missense possibly damaging 0.94
IGL01837:Ddx10 APN 9 53,140,498 (GRCm39) missense probably benign 0.16
IGL02036:Ddx10 APN 9 53,115,483 (GRCm39) missense probably benign 0.00
IGL02236:Ddx10 APN 9 53,146,682 (GRCm39) missense probably damaging 1.00
IGL02939:Ddx10 APN 9 53,115,579 (GRCm39) missense possibly damaging 0.63
IGL03294:Ddx10 APN 9 53,028,452 (GRCm39) critical splice donor site probably null
R0279:Ddx10 UTSW 9 53,146,604 (GRCm39) missense probably damaging 1.00
R1439:Ddx10 UTSW 9 53,151,787 (GRCm39) missense probably damaging 1.00
R1501:Ddx10 UTSW 9 53,145,297 (GRCm39) missense possibly damaging 0.85
R1529:Ddx10 UTSW 9 53,028,499 (GRCm39) nonsense probably null
R1548:Ddx10 UTSW 9 53,060,861 (GRCm39) critical splice acceptor site probably null
R1717:Ddx10 UTSW 9 53,071,253 (GRCm39) missense probably benign 0.25
R1720:Ddx10 UTSW 9 53,149,371 (GRCm39) missense probably damaging 1.00
R1781:Ddx10 UTSW 9 53,118,845 (GRCm39) missense probably damaging 1.00
R2007:Ddx10 UTSW 9 53,124,578 (GRCm39) missense probably benign 0.06
R2073:Ddx10 UTSW 9 53,151,805 (GRCm39) missense probably benign 0.28
R2075:Ddx10 UTSW 9 53,151,805 (GRCm39) missense probably benign 0.28
R2133:Ddx10 UTSW 9 53,060,812 (GRCm39) missense probably benign 0.13
R4660:Ddx10 UTSW 9 53,147,698 (GRCm39) critical splice donor site probably null
R4668:Ddx10 UTSW 9 53,010,513 (GRCm39) missense possibly damaging 0.55
R4706:Ddx10 UTSW 9 53,145,231 (GRCm39) missense probably damaging 1.00
R4814:Ddx10 UTSW 9 53,115,405 (GRCm39) missense possibly damaging 0.54
R5394:Ddx10 UTSW 9 53,145,157 (GRCm39) nonsense probably null
R5655:Ddx10 UTSW 9 53,120,987 (GRCm39) critical splice donor site probably null
R5874:Ddx10 UTSW 9 53,140,498 (GRCm39) missense possibly damaging 0.95
R6341:Ddx10 UTSW 9 53,115,551 (GRCm39) missense probably benign 0.00
R6534:Ddx10 UTSW 9 53,134,988 (GRCm39) missense probably damaging 1.00
R6801:Ddx10 UTSW 9 53,159,207 (GRCm39) nonsense probably null
R6994:Ddx10 UTSW 9 53,115,411 (GRCm39) missense probably damaging 0.99
R7155:Ddx10 UTSW 9 53,028,588 (GRCm39) missense probably benign 0.00
R7380:Ddx10 UTSW 9 53,151,786 (GRCm39) missense probably damaging 1.00
R7753:Ddx10 UTSW 9 53,136,904 (GRCm39) missense probably damaging 1.00
R8101:Ddx10 UTSW 9 53,136,820 (GRCm39) missense probably damaging 0.98
R8782:Ddx10 UTSW 9 53,146,588 (GRCm39) missense probably damaging 0.99
R8962:Ddx10 UTSW 9 53,149,377 (GRCm39) missense probably damaging 1.00
R8998:Ddx10 UTSW 9 53,140,534 (GRCm39) missense possibly damaging 0.64
R8999:Ddx10 UTSW 9 53,140,534 (GRCm39) missense possibly damaging 0.64
R9283:Ddx10 UTSW 9 53,146,656 (GRCm39) missense probably benign 0.01
X0019:Ddx10 UTSW 9 53,145,296 (GRCm39) missense probably damaging 1.00
X0063:Ddx10 UTSW 9 53,136,873 (GRCm39) missense probably damaging 1.00
Z1177:Ddx10 UTSW 9 53,115,811 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTAGAAAGCTCAATCAGTAACG -3'
(R):5'- CCAAATGAGGTTGCTCCATGG -3'

Sequencing Primer
(F):5'- GCTCAATCAGTAACGTGCATG -3'
(R):5'- AAGTGATGGTATGCTCCTAATTTTG -3'
Posted On 2014-08-25