Incidental Mutation 'R2005:Ddx50'
ID 225390
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene Name DExD box helicase 50
Synonyms RH-II/Gubeta, GU2, 4933429B04Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 50, 8430408E17Rik
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 62451674-62486997 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62476243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 306 (H306L)
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
AlphaFold Q99MJ9
Predicted Effect probably benign
Transcript: ENSMUST00000020270
AA Change: H306L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076
AA Change: H306L

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62,482,911 (GRCm39) missense probably benign
IGL01955:Ddx50 APN 10 62,482,962 (GRCm39) missense probably benign
IGL02677:Ddx50 APN 10 62,452,072 (GRCm39) missense unknown
IGL03169:Ddx50 APN 10 62,457,166 (GRCm39) critical splice donor site probably null
IGL03372:Ddx50 APN 10 62,479,109 (GRCm39) missense probably benign 0.11
K7371:Ddx50 UTSW 10 62,457,289 (GRCm39) start codon destroyed probably null
R0123:Ddx50 UTSW 10 62,457,156 (GRCm39) splice site probably benign
R0134:Ddx50 UTSW 10 62,457,156 (GRCm39) splice site probably benign
R0318:Ddx50 UTSW 10 62,478,616 (GRCm39) missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62,452,028 (GRCm39) missense unknown
R1244:Ddx50 UTSW 10 62,478,703 (GRCm39) missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62,482,847 (GRCm39) missense possibly damaging 0.45
R2924:Ddx50 UTSW 10 62,463,373 (GRCm39) missense probably damaging 1.00
R3803:Ddx50 UTSW 10 62,475,723 (GRCm39) missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62,478,725 (GRCm39) missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62,476,549 (GRCm39) nonsense probably null
R4917:Ddx50 UTSW 10 62,463,450 (GRCm39) nonsense probably null
R4918:Ddx50 UTSW 10 62,463,450 (GRCm39) nonsense probably null
R4951:Ddx50 UTSW 10 62,469,899 (GRCm39) missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62,478,632 (GRCm39) missense probably damaging 1.00
R5102:Ddx50 UTSW 10 62,476,640 (GRCm39) missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62,482,809 (GRCm39) missense probably benign
R5648:Ddx50 UTSW 10 62,452,049 (GRCm39) missense unknown
R5899:Ddx50 UTSW 10 62,476,596 (GRCm39) nonsense probably null
R6127:Ddx50 UTSW 10 62,457,342 (GRCm39) splice site probably null
R6244:Ddx50 UTSW 10 62,457,345 (GRCm39) splice site probably null
R8098:Ddx50 UTSW 10 62,460,922 (GRCm39) critical splice donor site probably null
R8163:Ddx50 UTSW 10 62,475,678 (GRCm39) missense possibly damaging 0.93
R8257:Ddx50 UTSW 10 62,452,299 (GRCm39) splice site probably benign
R8272:Ddx50 UTSW 10 62,457,256 (GRCm39) missense probably benign 0.05
R8356:Ddx50 UTSW 10 62,457,287 (GRCm39) missense probably benign 0.04
R8537:Ddx50 UTSW 10 62,478,628 (GRCm39) missense probably damaging 1.00
R8540:Ddx50 UTSW 10 62,476,569 (GRCm39) missense possibly damaging 0.94
R8759:Ddx50 UTSW 10 62,452,021 (GRCm39) missense unknown
R8995:Ddx50 UTSW 10 62,469,862 (GRCm39) missense probably damaging 1.00
R9001:Ddx50 UTSW 10 62,475,728 (GRCm39) missense probably benign 0.27
R9691:Ddx50 UTSW 10 62,476,524 (GRCm39) missense probably benign 0.03
R9799:Ddx50 UTSW 10 62,469,812 (GRCm39) missense probably damaging 1.00
X0026:Ddx50 UTSW 10 62,460,970 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTACGCTTTGGACTTTC -3'
(R):5'- CCAAGGCTGGATTGGCTAATC -3'

Sequencing Primer
(F):5'- TACCAGGAGACAAGGTAATA -3'
(R):5'- TCTTTCCTTGCAGTTAATCAAATTCG -3'
Posted On 2014-08-25