Incidental Mutation 'R2005:Icosl'
ID 225392
Institutional Source Beutler Lab
Gene Symbol Icosl
Ensembl Gene ENSMUSG00000000732
Gene Name icos ligand
Synonyms GL50, B7h, GL50-B, ICOS-L, B7RP-1, LICOS, B7-H2
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77904921-77915359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77907787 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 116 (M116L)
Ref Sequence ENSEMBL: ENSMUSP00000101032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105393]
AlphaFold Q9JHJ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000105393
AA Change: M116L

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101032
Gene: ENSMUSG00000000732
AA Change: M116L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
IG 47 161 4.67e-4 SMART
Pfam:C2-set_2 165 253 5.2e-9 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217675
Predicted Effect unknown
Transcript: ENSMUST00000219038
AA Change: M112L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219633
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit defects in the humoral immune response associated with an impaired interactions between T and B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Icosl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Icosl APN 10 77,907,805 (GRCm39) missense probably damaging 1.00
IGL02540:Icosl APN 10 77,905,370 (GRCm39) critical splice donor site probably null
R0304:Icosl UTSW 10 77,911,156 (GRCm39) missense probably benign
R0512:Icosl UTSW 10 77,907,800 (GRCm39) missense possibly damaging 0.77
R0584:Icosl UTSW 10 77,907,709 (GRCm39) missense possibly damaging 0.82
R0711:Icosl UTSW 10 77,909,775 (GRCm39) missense probably damaging 1.00
R2006:Icosl UTSW 10 77,907,787 (GRCm39) missense possibly damaging 0.63
R2189:Icosl UTSW 10 77,909,759 (GRCm39) missense possibly damaging 0.62
R3417:Icosl UTSW 10 77,907,869 (GRCm39) missense possibly damaging 0.46
R4423:Icosl UTSW 10 77,907,707 (GRCm39) missense possibly damaging 0.92
R5183:Icosl UTSW 10 77,905,319 (GRCm39) unclassified probably benign
R5579:Icosl UTSW 10 77,909,597 (GRCm39) missense probably damaging 0.99
R6388:Icosl UTSW 10 77,905,366 (GRCm39) missense possibly damaging 0.96
R7336:Icosl UTSW 10 77,909,707 (GRCm39) nonsense probably null
R7921:Icosl UTSW 10 77,909,786 (GRCm39) missense probably benign 0.02
R7921:Icosl UTSW 10 77,909,574 (GRCm39) missense probably benign 0.01
R8733:Icosl UTSW 10 77,909,697 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTGCAGAGACTGAAGTC -3'
(R):5'- AGCATCACACTGGGCTAAGC -3'

Sequencing Primer
(F):5'- ACTGAAGTCGGTGCAATGGTG -3'
(R):5'- ACACTGGGCTAAGCTAATCTCTG -3'
Posted On 2014-08-25