Incidental Mutation 'R2005:Or1e19'
ID 225398
Institutional Source Beutler Lab
Gene Symbol Or1e19
Ensembl Gene ENSMUSG00000055971
Gene Name olfactory receptor family 1 subfamily E member 19
Synonyms MOR135-2, GA_x6K02T2P1NL-3586282-3585338, Olfr378
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 73315863-73319303 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73316065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 248 (V248E)
Ref Sequence ENSEMBL: ENSMUSP00000066971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069790]
AlphaFold Q8VGT2
Predicted Effect probably damaging
Transcript: ENSMUST00000069790
AA Change: V248E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066971
Gene: ENSMUSG00000055971
AA Change: V248E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 297 7.9e-6 PFAM
Pfam:7tm_1 41 290 3.8e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Or1e19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Or1e19 APN 11 73,316,794 (GRCm39) missense probably damaging 1.00
IGL02427:Or1e19 APN 11 73,316,487 (GRCm39) missense probably damaging 1.00
IGL03089:Or1e19 APN 11 73,316,009 (GRCm39) missense probably benign
R0443:Or1e19 UTSW 11 73,316,581 (GRCm39) missense probably damaging 1.00
R1497:Or1e19 UTSW 11 73,316,653 (GRCm39) missense possibly damaging 0.88
R2029:Or1e19 UTSW 11 73,316,188 (GRCm39) missense probably benign 0.00
R2140:Or1e19 UTSW 11 73,316,707 (GRCm39) missense probably damaging 0.98
R3551:Or1e19 UTSW 11 73,316,678 (GRCm39) missense probably benign 0.00
R3552:Or1e19 UTSW 11 73,316,678 (GRCm39) missense probably benign 0.00
R4433:Or1e19 UTSW 11 73,316,537 (GRCm39) missense possibly damaging 0.50
R4546:Or1e19 UTSW 11 73,316,012 (GRCm39) missense probably benign 0.23
R4686:Or1e19 UTSW 11 73,316,264 (GRCm39) missense probably benign 0.35
R5168:Or1e19 UTSW 11 73,316,669 (GRCm39) missense probably benign 0.01
R5567:Or1e19 UTSW 11 73,316,272 (GRCm39) missense probably damaging 1.00
R5755:Or1e19 UTSW 11 73,316,557 (GRCm39) missense probably benign 0.22
R7190:Or1e19 UTSW 11 73,315,990 (GRCm39) missense probably benign 0.07
R7287:Or1e19 UTSW 11 73,316,669 (GRCm39) missense probably benign 0.01
R7404:Or1e19 UTSW 11 73,316,419 (GRCm39) missense probably damaging 1.00
R7462:Or1e19 UTSW 11 73,316,296 (GRCm39) missense probably benign 0.06
R7544:Or1e19 UTSW 11 73,316,596 (GRCm39) missense probably damaging 1.00
R7702:Or1e19 UTSW 11 73,324,175 (GRCm39) unclassified probably benign
R8408:Or1e19 UTSW 11 73,316,794 (GRCm39) missense probably damaging 1.00
R8977:Or1e19 UTSW 11 73,316,651 (GRCm39) missense probably benign 0.02
X0010:Or1e19 UTSW 11 73,315,977 (GRCm39) missense possibly damaging 0.59
Z1088:Or1e19 UTSW 11 73,315,931 (GRCm39) splice site probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGAAGGGAATTTGTCTTTTGCAC -3'
(R):5'- CTGTGAAGACAATGTGATCCCC -3'

Sequencing Primer
(F):5'- GGGAATTTGTCTTTTGCACATTATC -3'
(R):5'- AAAGTGGCTTGTTCTGACACC -3'
Posted On 2014-08-25