Incidental Mutation 'R0144:AI661453'
ID22540
Institutional Source Beutler Lab
Gene Symbol AI661453
Ensembl Gene ENSMUSG00000034382
Gene Nameexpressed sequence AI661453
Synonyms
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0144 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location47436615-47470638 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 47469299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000150819]
Predicted Effect probably benign
Transcript: ENSMUST00000037701
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150819
AA Change: Y1176F
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382
AA Change: Y1176F

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in AI661453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:AI661453 APN 17 47466623 intron probably benign
IGL01995:AI661453 APN 17 47468517 intron probably benign
IGL02171:AI661453 APN 17 47466996 intron probably benign
IGL02411:AI661453 APN 17 47467338 intron probably benign
IGL02422:AI661453 APN 17 47467092 intron probably benign
IGL02609:AI661453 APN 17 47468372 intron probably benign
IGL02888:AI661453 APN 17 47467404 intron probably benign
IGL03024:AI661453 APN 17 47446588 missense probably damaging 1.00
R0077:AI661453 UTSW 17 47469362 intron probably benign
R0092:AI661453 UTSW 17 47467515 intron probably benign
R0330:AI661453 UTSW 17 47446646 missense probably damaging 1.00
R0590:AI661453 UTSW 17 47467074 intron probably benign
R0839:AI661453 UTSW 17 47436827 missense probably null 0.97
R1350:AI661453 UTSW 17 47467928 nonsense probably null
R1436:AI661453 UTSW 17 47466702 intron probably benign
R1439:AI661453 UTSW 17 47466662 intron probably benign
R1643:AI661453 UTSW 17 47467866 intron probably benign
R1994:AI661453 UTSW 17 47467034 intron probably benign
R2145:AI661453 UTSW 17 47466098 intron probably benign
R2986:AI661453 UTSW 17 47466772 nonsense probably null
R4398:AI661453 UTSW 17 47468117 intron probably benign
R4809:AI661453 UTSW 17 47467187 intron probably benign
R4913:AI661453 UTSW 17 47468555 nonsense probably null
R4972:AI661453 UTSW 17 47466399 intron probably benign
R6430:AI661453 UTSW 17 47466797 intron probably benign
R6687:AI661453 UTSW 17 47467002 intron probably benign
R7494:AI661453 UTSW 17 47468180 missense unknown
R7598:AI661453 UTSW 17 47466120 missense unknown
R7635:AI661453 UTSW 17 47467751 missense unknown
R7753:AI661453 UTSW 17 47467514 nonsense probably null
R8022:AI661453 UTSW 17 47466236 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCACCGAGGTCAAGTTCAAG -3'
(R):5'- TTCCAGCACAATGGCTCTCAGC -3'

Sequencing Primer
(F):5'- TCGCCTGCGACTTACTAAGAG -3'
(R):5'- GTCTGAGCTGGGACCTATAATACC -3'
Posted On2013-04-16