Incidental Mutation 'R2005:Slfn8'
ID 225402
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 82892984-82911636 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82894976 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 610 (M610K)
Ref Sequence ENSEMBL: ENSMUSP00000114417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect probably damaging
Transcript: ENSMUST00000038141
AA Change: M610K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: M610K

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092838
AA Change: M610K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: M610K

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130822
AA Change: M610K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: M610K

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131883
AA Change: M386K
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: M386K

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 82,904,310 (GRCm39) missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 82,895,462 (GRCm39) missense probably damaging 1.00
IGL01620:Slfn8 APN 11 82,895,059 (GRCm39) nonsense probably null
IGL01875:Slfn8 APN 11 82,894,905 (GRCm39) missense probably benign 0.30
IGL01896:Slfn8 APN 11 82,894,522 (GRCm39) missense probably damaging 1.00
IGL01929:Slfn8 APN 11 82,894,231 (GRCm39) nonsense probably null
IGL02111:Slfn8 APN 11 82,895,324 (GRCm39) missense probably damaging 1.00
IGL02136:Slfn8 APN 11 82,894,291 (GRCm39) nonsense probably null
IGL02165:Slfn8 APN 11 82,908,022 (GRCm39) missense probably benign 0.00
IGL02645:Slfn8 APN 11 82,894,380 (GRCm39) missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 82,894,517 (GRCm39) missense probably damaging 1.00
IGL02689:Slfn8 APN 11 82,907,934 (GRCm39) missense probably damaging 1.00
IGL02948:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03037:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03185:Slfn8 APN 11 82,908,333 (GRCm39) missense probably benign 0.01
IGL03243:Slfn8 APN 11 82,894,533 (GRCm39) missense probably damaging 1.00
IGL03286:Slfn8 APN 11 82,904,294 (GRCm39) missense probably damaging 0.99
seven_dwarfs UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
vanwinkle UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R0295:Slfn8 UTSW 11 82,894,169 (GRCm39) nonsense probably null
R0368:Slfn8 UTSW 11 82,907,958 (GRCm39) missense probably damaging 1.00
R0382:Slfn8 UTSW 11 82,895,382 (GRCm39) missense probably damaging 1.00
R0655:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R0894:Slfn8 UTSW 11 82,894,407 (GRCm39) missense probably benign 0.07
R1006:Slfn8 UTSW 11 82,894,337 (GRCm39) missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 82,907,571 (GRCm39) missense probably benign 0.19
R1187:Slfn8 UTSW 11 82,894,314 (GRCm39) missense probably damaging 1.00
R1501:Slfn8 UTSW 11 82,894,006 (GRCm39) missense probably damaging 0.99
R1646:Slfn8 UTSW 11 82,907,712 (GRCm39) missense probably damaging 1.00
R1909:Slfn8 UTSW 11 82,894,447 (GRCm39) nonsense probably null
R2363:Slfn8 UTSW 11 82,894,920 (GRCm39) missense probably damaging 1.00
R3780:Slfn8 UTSW 11 82,908,280 (GRCm39) missense probably benign 0.13
R3890:Slfn8 UTSW 11 82,895,270 (GRCm39) missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 82,907,819 (GRCm39) nonsense probably null
R4559:Slfn8 UTSW 11 82,895,570 (GRCm39) missense probably damaging 1.00
R4684:Slfn8 UTSW 11 82,908,332 (GRCm39) missense probably benign 0.10
R4767:Slfn8 UTSW 11 82,894,023 (GRCm39) missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R4859:Slfn8 UTSW 11 82,908,540 (GRCm39) start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 82,907,704 (GRCm39) missense probably damaging 1.00
R4939:Slfn8 UTSW 11 82,894,111 (GRCm39) missense probably benign 0.01
R5107:Slfn8 UTSW 11 82,907,976 (GRCm39) missense probably damaging 0.99
R5130:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R5165:Slfn8 UTSW 11 82,907,953 (GRCm39) missense probably damaging 0.99
R5238:Slfn8 UTSW 11 82,904,214 (GRCm39) missense probably damaging 0.96
R5282:Slfn8 UTSW 11 82,908,550 (GRCm39) critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 82,894,910 (GRCm39) missense probably damaging 1.00
R5499:Slfn8 UTSW 11 82,895,042 (GRCm39) missense probably damaging 0.99
R5617:Slfn8 UTSW 11 82,895,547 (GRCm39) missense probably benign 0.01
R5782:Slfn8 UTSW 11 82,907,867 (GRCm39) missense probably damaging 0.98
R5823:Slfn8 UTSW 11 82,907,562 (GRCm39) missense probably benign 0.01
R5886:Slfn8 UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
R5933:Slfn8 UTSW 11 82,894,161 (GRCm39) missense probably benign 0.00
R6151:Slfn8 UTSW 11 82,908,147 (GRCm39) missense probably damaging 1.00
R6163:Slfn8 UTSW 11 82,894,690 (GRCm39) makesense probably null
R6191:Slfn8 UTSW 11 82,907,626 (GRCm39) missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 82,894,881 (GRCm39) splice site probably null
R6925:Slfn8 UTSW 11 82,904,243 (GRCm39) nonsense probably null
R7065:Slfn8 UTSW 11 82,907,794 (GRCm39) missense probably benign 0.01
R7380:Slfn8 UTSW 11 82,894,566 (GRCm39) missense not run
R7414:Slfn8 UTSW 11 82,907,618 (GRCm39) nonsense probably null
R7819:Slfn8 UTSW 11 82,895,081 (GRCm39) missense probably damaging 1.00
R8425:Slfn8 UTSW 11 82,895,441 (GRCm39) missense possibly damaging 0.80
R8517:Slfn8 UTSW 11 82,894,968 (GRCm39) missense possibly damaging 0.68
R8804:Slfn8 UTSW 11 82,907,639 (GRCm39) missense possibly damaging 0.94
R8814:Slfn8 UTSW 11 82,907,505 (GRCm39) missense possibly damaging 0.95
R9069:Slfn8 UTSW 11 82,907,902 (GRCm39) missense probably damaging 1.00
R9233:Slfn8 UTSW 11 82,894,422 (GRCm39) missense probably damaging 1.00
R9457:Slfn8 UTSW 11 82,908,532 (GRCm39) missense probably benign
R9678:Slfn8 UTSW 11 82,907,723 (GRCm39) missense probably damaging 1.00
R9708:Slfn8 UTSW 11 82,894,267 (GRCm39) missense probably benign 0.00
R9764:Slfn8 UTSW 11 82,907,838 (GRCm39) missense probably damaging 1.00
X0021:Slfn8 UTSW 11 82,907,754 (GRCm39) missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 82,894,359 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAGTATGTCATAGTCCCAGCAACAC -3'
(R):5'- TGCAGGCCCTTGTGATTGTC -3'

Sequencing Primer
(F):5'- CATTTGACTGACTAGTTCCCAAG -3'
(R):5'- GTGATTGTCTTGCTCAACTTCAG -3'
Posted On 2014-08-25