Incidental Mutation 'R2005:Wnk4'
ID 225404
Institutional Source Beutler Lab
Gene Symbol Wnk4
Ensembl Gene ENSMUSG00000035112
Gene Name WNK lysine deficient protein kinase 4
Synonyms 2010002J11Rik, Prkwnk4
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 101151393-101168235 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101154716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 302 (C302R)
Ref Sequence ENSEMBL: ENSMUSP00000131298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042477] [ENSMUST00000100414] [ENSMUST00000103108] [ENSMUST00000107280] [ENSMUST00000121331] [ENSMUST00000128260] [ENSMUST00000139487] [ENSMUST00000144306] [ENSMUST00000147741] [ENSMUST00000170056]
AlphaFold Q80UE6
Predicted Effect probably benign
Transcript: ENSMUST00000042477
SMART Domains Protein: ENSMUSP00000042088
Gene: ENSMUSG00000078656

DomainStartEndE-ValueType
Pfam:ESCRT-II 9 147 1.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100414
SMART Domains Protein: ENSMUSP00000097981
Gene: ENSMUSG00000078656

DomainStartEndE-ValueType
Pfam:ESCRT-II 9 144 5e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103108
AA Change: C302R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: C302R

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 427 4.7e-42 PFAM
Pfam:Pkinase 171 429 9e-55 PFAM
Pfam:OSR1_C 450 486 3e-18 PFAM
low complexity region 503 513 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 757 778 N/A INTRINSIC
low complexity region 793 808 N/A INTRINSIC
low complexity region 841 877 N/A INTRINSIC
low complexity region 882 915 N/A INTRINSIC
low complexity region 921 951 N/A INTRINSIC
low complexity region 1014 1033 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107280
SMART Domains Protein: ENSMUSP00000102901
Gene: ENSMUSG00000078656

DomainStartEndE-ValueType
Pfam:ESCRT-II 10 153 7.2e-56 PFAM
low complexity region 155 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121331
SMART Domains Protein: ENSMUSP00000114100
Gene: ENSMUSG00000078656

DomainStartEndE-ValueType
Pfam:ESCRT-II 1 99 1.8e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123529
Predicted Effect probably benign
Transcript: ENSMUST00000128260
SMART Domains Protein: ENSMUSP00000127718
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139487
AA Change: V285A
SMART Domains Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112
AA Change: V285A

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 242 4e-8 PFAM
Pfam:Pkinase 171 252 1.9e-10 PFAM
low complexity region 269 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144306
SMART Domains Protein: ENSMUSP00000131026
Gene: ENSMUSG00000078656

DomainStartEndE-ValueType
Pfam:ESCRT-II 9 91 2.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147741
AA Change: C302R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112
AA Change: C302R

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase 171 394 9.3e-50 PFAM
Pfam:Pkinase_Tyr 171 399 3.7e-38 PFAM
low complexity region 401 413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156205
Predicted Effect probably benign
Transcript: ENSMUST00000170056
SMART Domains Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
Pfam:OSR1_C 13 49 8.6e-20 PFAM
low complexity region 66 76 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Wnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wnk4 APN 11 101,159,574 (GRCm39) missense possibly damaging 0.47
IGL00535:Wnk4 APN 11 101,155,175 (GRCm39) missense probably damaging 1.00
IGL01401:Wnk4 APN 11 101,167,509 (GRCm39) splice site probably benign
IGL01931:Wnk4 APN 11 101,159,310 (GRCm39) missense possibly damaging 0.94
IGL01977:Wnk4 APN 11 101,156,240 (GRCm39) missense probably damaging 1.00
IGL02165:Wnk4 APN 11 101,166,117 (GRCm39) unclassified probably benign
IGL02197:Wnk4 APN 11 101,154,783 (GRCm39) missense probably damaging 1.00
IGL02457:Wnk4 APN 11 101,160,389 (GRCm39) splice site probably benign
IGL02963:Wnk4 APN 11 101,167,039 (GRCm39) unclassified probably benign
ashamed UTSW 11 101,156,257 (GRCm39) missense probably damaging 1.00
blushing UTSW 11 101,156,203 (GRCm39) missense probably damaging 0.96
Caught_dead UTSW 11 101,155,156 (GRCm39) missense probably damaging 1.00
lowered UTSW 11 101,159,318 (GRCm39) critical splice donor site probably null
mortification UTSW 11 101,154,720 (GRCm39) makesense probably null
shame UTSW 11 101,153,682 (GRCm39) missense probably damaging 1.00
R0066:Wnk4 UTSW 11 101,156,261 (GRCm39) missense probably damaging 1.00
R0317:Wnk4 UTSW 11 101,159,630 (GRCm39) missense probably benign 0.01
R0628:Wnk4 UTSW 11 101,165,849 (GRCm39) missense probably benign 0.10
R0630:Wnk4 UTSW 11 101,156,212 (GRCm39) missense probably damaging 1.00
R0710:Wnk4 UTSW 11 101,164,932 (GRCm39) missense probably benign 0.22
R1290:Wnk4 UTSW 11 101,167,166 (GRCm39) unclassified probably benign
R1482:Wnk4 UTSW 11 101,160,462 (GRCm39) missense probably damaging 0.99
R1775:Wnk4 UTSW 11 101,167,166 (GRCm39) unclassified probably benign
R2229:Wnk4 UTSW 11 101,166,467 (GRCm39) unclassified probably benign
R2258:Wnk4 UTSW 11 101,165,861 (GRCm39) missense probably damaging 0.98
R2323:Wnk4 UTSW 11 101,159,307 (GRCm39) missense probably damaging 0.99
R3081:Wnk4 UTSW 11 101,167,717 (GRCm39) splice site probably benign
R3763:Wnk4 UTSW 11 101,160,114 (GRCm39) missense probably benign 0.00
R4196:Wnk4 UTSW 11 101,160,457 (GRCm39) missense probably damaging 1.00
R4447:Wnk4 UTSW 11 101,159,277 (GRCm39) missense possibly damaging 0.65
R4614:Wnk4 UTSW 11 101,164,937 (GRCm39) missense probably benign 0.00
R4751:Wnk4 UTSW 11 101,167,188 (GRCm39) unclassified probably benign
R4948:Wnk4 UTSW 11 101,159,107 (GRCm39) missense probably damaging 1.00
R5067:Wnk4 UTSW 11 101,153,682 (GRCm39) missense probably damaging 1.00
R5073:Wnk4 UTSW 11 101,152,014 (GRCm39) missense probably damaging 1.00
R5107:Wnk4 UTSW 11 101,166,364 (GRCm39) unclassified probably benign
R5181:Wnk4 UTSW 11 101,156,203 (GRCm39) missense probably damaging 0.96
R5205:Wnk4 UTSW 11 101,155,964 (GRCm39) missense possibly damaging 0.89
R5252:Wnk4 UTSW 11 101,159,574 (GRCm39) missense possibly damaging 0.47
R5273:Wnk4 UTSW 11 101,154,695 (GRCm39) missense probably damaging 1.00
R5293:Wnk4 UTSW 11 101,166,023 (GRCm39) unclassified probably benign
R5609:Wnk4 UTSW 11 101,166,462 (GRCm39) unclassified probably benign
R5915:Wnk4 UTSW 11 101,154,720 (GRCm39) makesense probably null
R5931:Wnk4 UTSW 11 101,152,047 (GRCm39) missense probably damaging 0.99
R6126:Wnk4 UTSW 11 101,167,174 (GRCm39) unclassified probably benign
R6164:Wnk4 UTSW 11 101,165,894 (GRCm39) missense possibly damaging 0.56
R6191:Wnk4 UTSW 11 101,155,156 (GRCm39) missense probably damaging 1.00
R6267:Wnk4 UTSW 11 101,164,824 (GRCm39) missense probably damaging 1.00
R6274:Wnk4 UTSW 11 101,156,257 (GRCm39) missense probably damaging 1.00
R6296:Wnk4 UTSW 11 101,164,824 (GRCm39) missense probably damaging 1.00
R7132:Wnk4 UTSW 11 101,152,026 (GRCm39) missense probably benign 0.22
R7251:Wnk4 UTSW 11 101,155,979 (GRCm39) missense possibly damaging 0.70
R7352:Wnk4 UTSW 11 101,155,244 (GRCm39) missense probably damaging 1.00
R7404:Wnk4 UTSW 11 101,159,318 (GRCm39) critical splice donor site probably null
R7624:Wnk4 UTSW 11 101,155,180 (GRCm39) nonsense probably null
R7634:Wnk4 UTSW 11 101,153,721 (GRCm39) missense probably damaging 1.00
R7780:Wnk4 UTSW 11 101,160,403 (GRCm39) missense probably damaging 0.96
R8006:Wnk4 UTSW 11 101,159,182 (GRCm39) missense probably benign 0.00
R8046:Wnk4 UTSW 11 101,164,918 (GRCm39) missense probably benign 0.20
R8143:Wnk4 UTSW 11 101,153,625 (GRCm39) missense probably damaging 1.00
R8458:Wnk4 UTSW 11 101,166,147 (GRCm39) nonsense probably null
R8735:Wnk4 UTSW 11 101,167,092 (GRCm39) missense unknown
R9025:Wnk4 UTSW 11 101,153,641 (GRCm39) nonsense probably null
R9206:Wnk4 UTSW 11 101,164,882 (GRCm39) missense probably damaging 1.00
R9295:Wnk4 UTSW 11 101,160,078 (GRCm39) missense probably damaging 0.98
R9610:Wnk4 UTSW 11 101,159,250 (GRCm39) nonsense probably null
R9611:Wnk4 UTSW 11 101,159,250 (GRCm39) nonsense probably null
R9674:Wnk4 UTSW 11 101,166,874 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAATAGATATCCCCGCCCTG -3'
(R):5'- ACTCTTGCCCAAAGCCTGTG -3'

Sequencing Primer
(F):5'- GCCCTGACCATGGTTACAC -3'
(R):5'- CCTAGATCAATAGCTCTGCTGGAG -3'
Posted On 2014-08-25